Incidental Mutation 'R7235:Uxs1'
ID562736
Institutional Source Beutler Lab
Gene Symbol Uxs1
Ensembl Gene ENSMUSG00000057363
Gene NameUDP-glucuronate decarboxylase 1
Synonyms1600025I13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7235 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location43746966-43827800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43764927 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 276 (N276S)
Ref Sequence ENSEMBL: ENSMUSP00000119939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076997] [ENSMUST00000126008] [ENSMUST00000139451]
Predicted Effect probably benign
Transcript: ENSMUST00000076997
SMART Domains Protein: ENSMUSP00000076259
Gene: ENSMUSG00000057363

DomainStartEndE-ValueType
Pfam:UXS1_N 1 78 5.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126008
AA Change: N276S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119939
Gene: ENSMUSG00000057363
AA Change: N276S

DomainStartEndE-ValueType
Pfam:UXS1_N 4 78 2.3e-40 PFAM
Pfam:RmlD_sub_bind 89 370 1.1e-11 PFAM
Pfam:Polysacc_synt_2 91 207 2.7e-6 PFAM
Pfam:Epimerase 91 324 9.8e-52 PFAM
Pfam:3Beta_HSD 92 305 1.8e-9 PFAM
Pfam:GDP_Man_Dehyd 92 387 1.3e-58 PFAM
Pfam:NAD_binding_4 129 297 4.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139451
SMART Domains Protein: ENSMUSP00000118468
Gene: ENSMUSG00000057363

DomainStartEndE-ValueType
Pfam:UXS1_N 1 83 4.4e-38 PFAM
Pfam:RmlD_sub_bind 94 254 2.6e-9 PFAM
Pfam:Polysacc_synt_2 96 211 1.2e-6 PFAM
Pfam:Epimerase 96 254 2.9e-27 PFAM
Pfam:3Beta_HSD 97 251 2.5e-9 PFAM
Pfam:NAD_binding_4 125 254 1.1e-6 PFAM
Meta Mutation Damage Score 0.2446 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme found in the perinuclear Golgi which catalyzes the synthesis of UDP-xylose used in glycosaminoglycan (GAG) synthesis on proteoglycans. The GAG chains are covalently attached to proteoglycans which participate in signaling pathways during development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele die prenatally. Heterozygous mice exhibit an increased mean serum IgG2a response to ovalbumin challenge when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T G 2: 85,500,219 H248P probably damaging Het
Ahnak T A 19: 9,012,488 M3712K unknown Het
Bri3bp A G 5: 125,441,684 E8G unknown Het
Brip1 C T 11: 86,138,875 R611Q possibly damaging Het
C330027C09Rik T A 16: 49,001,059 L176H probably damaging Het
Carm1 T G 9: 21,587,405 probably benign Het
Catsper4 A T 4: 134,212,581 probably null Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Clk4 A G 11: 51,276,185 D330G probably damaging Het
Dcdc2c A G 12: 28,470,719 S453P Het
Ddx46 G A 13: 55,663,240 V550I probably benign Het
Dennd1a T C 2: 37,801,061 N676D probably benign Het
Dnah3 T C 7: 120,032,670 N1365S probably damaging Het
Dsg1b T C 18: 20,399,423 V508A probably benign Het
Dus2 T C 8: 106,015,955 V39A possibly damaging Het
Dync1li1 T C 9: 114,715,163 V301A possibly damaging Het
Efcc1 T G 6: 87,753,798 S513A probably benign Het
Eif3f T C 7: 108,938,088 V167A possibly damaging Het
Ephb2 A G 4: 136,693,828 Y404H probably damaging Het
Eqtn A T 4: 94,923,699 D152E probably damaging Het
Ercc5 A C 1: 44,178,203 K902T possibly damaging Het
Erlec1 T A 11: 30,950,751 E139V possibly damaging Het
Evl G A 12: 108,648,460 G38R probably damaging Het
Foxd2 T C 4: 114,908,271 N184S unknown Het
Frem3 T C 8: 80,690,725 Y2020H probably benign Het
Ganc T C 2: 120,433,717 F384L probably damaging Het
Gm11756 G T 4: 73,917,571 L219M probably benign Het
Grin2a A G 16: 9,579,265 L986P probably damaging Het
Ift140 A T 17: 25,020,645 D92V possibly damaging Het
Inpp5b A G 4: 124,751,392 K158E probably benign Het
Iscu T A 5: 113,776,882 S152T probably benign Het
Isl2 C T 9: 55,544,171 T115I probably benign Het
Kalrn T A 16: 34,175,761 T1542S probably benign Het
Kat6a A G 8: 22,914,269 D454G possibly damaging Het
Kcnj10 T C 1: 172,369,426 I169T probably damaging Het
Klk12 T C 7: 43,773,299 S217P probably damaging Het
Lancl1 T C 1: 67,038,535 N14S probably benign Het
Map2 A G 1: 66,414,648 Y899C probably damaging Het
Nr1h5 C T 3: 102,949,042 probably null Het
Nup98 T C 7: 102,125,284 T1515A probably damaging Het
Obscn A C 11: 59,080,840 V2183G probably damaging Het
Olfr666 C T 7: 104,892,719 R303Q probably benign Het
Osbpl8 A G 10: 111,269,427 T248A probably benign Het
Pias3 T A 3: 96,704,363 S533T probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxna1 A G 6: 89,340,591 Y680H probably damaging Het
Pnliprp2 A G 19: 58,775,227 N436S probably benign Het
Pold1 T A 7: 44,541,820 M196L probably benign Het
Prkdc G A 16: 15,714,263 V1464I probably benign Het
Ptk2b G A 14: 66,157,087 Q857* probably null Het
Qars T A 9: 108,510,132 L185Q probably damaging Het
Rabep1 A G 11: 70,940,464 N859S probably benign Het
Rnf19b A G 4: 129,083,778 H156R Het
Sart3 T C 5: 113,753,642 Q423R probably damaging Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Slc6a21 C T 7: 45,280,758 H194Y probably damaging Het
Tcf4 G A 18: 69,657,795 V420I probably damaging Het
Tjp1 T C 7: 65,318,573 D701G probably benign Het
Trim42 T C 9: 97,369,708 D46G probably damaging Het
Usp19 C T 9: 108,494,924 R429* probably null Het
Vps50 A G 6: 3,588,078 I684V probably benign Het
Yars2 T A 16: 16,304,692 D307E probably benign Het
Zfp934 A T 13: 62,518,150 C258S Het
Other mutations in Uxs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Uxs1 APN 1 43757013 missense probably benign 0.03
IGL02210:Uxs1 APN 1 43750286 missense possibly damaging 0.95
IGL03203:Uxs1 APN 1 43807344 intron probably benign
R0505:Uxs1 UTSW 1 43764886 splice site probably null
R1464:Uxs1 UTSW 1 43764916 nonsense probably null
R1464:Uxs1 UTSW 1 43764916 nonsense probably null
R1720:Uxs1 UTSW 1 43764921 missense probably damaging 1.00
R2079:Uxs1 UTSW 1 43764973 missense probably damaging 1.00
R2113:Uxs1 UTSW 1 43771773 missense probably damaging 1.00
R2124:Uxs1 UTSW 1 43774846 missense probably damaging 1.00
R2145:Uxs1 UTSW 1 43827623 missense probably damaging 1.00
R4025:Uxs1 UTSW 1 43802616 intron probably benign
R4210:Uxs1 UTSW 1 43750238 missense possibly damaging 0.95
R4722:Uxs1 UTSW 1 43774846 missense probably damaging 1.00
R5321:Uxs1 UTSW 1 43805645 missense probably damaging 0.96
R5527:Uxs1 UTSW 1 43780080 missense probably damaging 1.00
R5854:Uxs1 UTSW 1 43780073 missense probably damaging 1.00
R6353:Uxs1 UTSW 1 43797250 missense probably damaging 0.99
R7205:Uxs1 UTSW 1 43816958 intron probably benign
R7474:Uxs1 UTSW 1 43757024 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCCAAGGTTCACTGTAAGGC -3'
(R):5'- AAAGAATCCTGGTCTCCATCC -3'

Sequencing Primer
(F):5'- AAGGTTCACTGTAAGGCTATTCCCG -3'
(R):5'- GGTCTCCATCCTTGCAGG -3'
Posted On2019-06-26