Incidental Mutation 'R5321:Uxs1'
ID406096
Institutional Source Beutler Lab
Gene Symbol Uxs1
Ensembl Gene ENSMUSG00000057363
Gene NameUDP-glucuronate decarboxylase 1
Synonyms1600025I13Rik
MMRRC Submission 042904-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5321 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location43746966-43827800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43805645 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 51 (I51T)
Ref Sequence ENSEMBL: ENSMUSP00000116719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076997] [ENSMUST00000126008] [ENSMUST00000128261] [ENSMUST00000136704] [ENSMUST00000139451] [ENSMUST00000153317]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076997
AA Change: I51T

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076259
Gene: ENSMUSG00000057363
AA Change: I51T

DomainStartEndE-ValueType
Pfam:UXS1_N 1 78 5.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126008
AA Change: I51T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119939
Gene: ENSMUSG00000057363
AA Change: I51T

DomainStartEndE-ValueType
Pfam:UXS1_N 4 78 2.3e-40 PFAM
Pfam:RmlD_sub_bind 89 370 1.1e-11 PFAM
Pfam:Polysacc_synt_2 91 207 2.7e-6 PFAM
Pfam:Epimerase 91 324 9.8e-52 PFAM
Pfam:3Beta_HSD 92 305 1.8e-9 PFAM
Pfam:GDP_Man_Dehyd 92 387 1.3e-58 PFAM
Pfam:NAD_binding_4 129 297 4.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128261
AA Change: I51T

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116719
Gene: ENSMUSG00000057363
AA Change: I51T

DomainStartEndE-ValueType
Pfam:UXS1_N 1 77 3.3e-38 PFAM
transmembrane domain 79 101 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134860
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136179
Predicted Effect probably benign
Transcript: ENSMUST00000136704
Predicted Effect probably benign
Transcript: ENSMUST00000139451
AA Change: I56T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118468
Gene: ENSMUSG00000057363
AA Change: I56T

DomainStartEndE-ValueType
Pfam:UXS1_N 1 83 4.4e-38 PFAM
Pfam:RmlD_sub_bind 94 254 2.6e-9 PFAM
Pfam:Polysacc_synt_2 96 211 1.2e-6 PFAM
Pfam:Epimerase 96 254 2.9e-27 PFAM
Pfam:3Beta_HSD 97 251 2.5e-9 PFAM
Pfam:NAD_binding_4 125 254 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153317
SMART Domains Protein: ENSMUSP00000144114
Gene: ENSMUSG00000057363

DomainStartEndE-ValueType
Pfam:Epimerase 14 110 1.2e-13 PFAM
Pfam:GDP_Man_Dehyd 22 110 4.5e-18 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme found in the perinuclear Golgi which catalyzes the synthesis of UDP-xylose used in glycosaminoglycan (GAG) synthesis on proteoglycans. The GAG chains are covalently attached to proteoglycans which participate in signaling pathways during development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null allele die prenatally. Heterozygous mice exhibit an increased mean serum IgG2a response to ovalbumin challenge when compared with that of controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,327,825 F72L probably benign Het
Btrc G A 19: 45,507,758 V211M probably damaging Het
Col6a5 A T 9: 105,928,465 Y1081N unknown Het
Cryzl1 T C 16: 91,707,230 Y109C probably benign Het
Dlec1 T A 9: 119,112,601 S352T probably benign Het
Dzip3 T G 16: 48,957,675 T349P possibly damaging Het
Endou A G 15: 97,721,032 V37A probably damaging Het
Exosc1 A T 19: 41,924,060 C129* probably null Het
Flywch1 C G 17: 23,756,651 R539P probably damaging Het
Gm14410 G A 2: 177,193,505 T322I probably damaging Het
Gm340 G T 19: 41,585,204 W799C probably damaging Het
Lpin2 G A 17: 71,246,858 V857M probably damaging Het
Olfr629 T C 7: 103,740,655 N195S probably damaging Het
Patl1 A G 19: 11,921,421 Q160R probably damaging Het
Phtf1 C T 3: 104,003,511 T606I probably benign Het
Polr3a T C 14: 24,454,941 I1084V possibly damaging Het
Scrt1 T C 15: 76,519,170 S207G unknown Het
Slc15a5 G T 6: 137,987,438 N496K probably benign Het
Slc17a2 A T 13: 23,812,631 I40F possibly damaging Het
Tdrd12 A C 7: 35,478,094 V945G probably damaging Het
Tdrkh C A 3: 94,425,658 L169I probably damaging Het
Tmem59l A G 8: 70,487,215 C35R probably damaging Het
Tpte A T 8: 22,297,203 R33* probably null Het
Trpv2 T A 11: 62,584,571 L270H probably damaging Het
Utp18 A G 11: 93,866,434 L468P probably damaging Het
Vmn1r20 C T 6: 57,432,442 S251L probably benign Het
Vmn1r24 A T 6: 57,956,197 L112* probably null Het
Vmn1r5 T C 6: 56,985,607 L89P probably damaging Het
Vmn2r10 G T 5: 108,995,639 A815E probably damaging Het
Zfp119a A T 17: 55,865,595 L416H probably damaging Het
Other mutations in Uxs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Uxs1 APN 1 43757013 missense probably benign 0.03
IGL02210:Uxs1 APN 1 43750286 missense possibly damaging 0.95
IGL03203:Uxs1 APN 1 43807344 intron probably benign
excess UTSW 1 43764927 missense probably damaging 0.96
R0505:Uxs1 UTSW 1 43764886 splice site probably null
R1464:Uxs1 UTSW 1 43764916 nonsense probably null
R1464:Uxs1 UTSW 1 43764916 nonsense probably null
R1720:Uxs1 UTSW 1 43764921 missense probably damaging 1.00
R2079:Uxs1 UTSW 1 43764973 missense probably damaging 1.00
R2113:Uxs1 UTSW 1 43771773 missense probably damaging 1.00
R2124:Uxs1 UTSW 1 43774846 missense probably damaging 1.00
R2145:Uxs1 UTSW 1 43827623 missense probably damaging 1.00
R4025:Uxs1 UTSW 1 43802616 intron probably benign
R4210:Uxs1 UTSW 1 43750238 missense possibly damaging 0.95
R4722:Uxs1 UTSW 1 43774846 missense probably damaging 1.00
R5527:Uxs1 UTSW 1 43780080 missense probably damaging 1.00
R5854:Uxs1 UTSW 1 43780073 missense probably damaging 1.00
R6353:Uxs1 UTSW 1 43797250 missense probably damaging 0.99
R7205:Uxs1 UTSW 1 43816958 intron probably benign
R7235:Uxs1 UTSW 1 43764927 missense probably damaging 0.96
R7474:Uxs1 UTSW 1 43757024 missense possibly damaging 0.95
R8190:Uxs1 UTSW 1 43771751 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTAGCTTAACACTGGAGGGTTG -3'
(R):5'- CCACTTATTTATAGACCTGTGAGGAG -3'

Sequencing Primer
(F):5'- AGGGTTGCGTGGCATAAGC -3'
(R):5'- TTTATAGACCTGTGAGGAGATTCC -3'
Posted On2016-07-22