Incidental Mutation 'R7317:Sept12'
ID563496
Institutional Source Beutler Lab
Gene Symbol Sept12
Ensembl Gene ENSMUSG00000022542
Gene Nameseptin 12
SynonymsSeptin12, 1700028G04Rik, 4933413B09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7317 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location4986858-4997852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4991735 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 238 (K238E)
Ref Sequence ENSEMBL: ENSMUSP00000131062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170323] [ENSMUST00000229321] [ENSMUST00000230362]
Predicted Effect probably damaging
Transcript: ENSMUST00000170323
AA Change: K238E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131062
Gene: ENSMUSG00000022542
AA Change: K238E

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
Pfam:Septin 44 277 1.4e-85 PFAM
Pfam:MMR_HSR1 49 248 3.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229321
AA Change: K238E

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230362
AA Change: K238E

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Chimeric male mice are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,263,647 V200A probably benign Het
Adam22 G A 5: 8,090,202 P832L probably benign Het
Adamts17 C T 7: 66,840,556 R129* probably null Het
Alg5 G T 3: 54,749,331 R321L probably benign Het
Amotl1 T A 9: 14,575,219 T460S probably benign Het
Ankrd50 T C 3: 38,483,183 E7G possibly damaging Het
Ap3b2 T C 7: 81,461,028 T1000A unknown Het
Arap2 G A 5: 62,649,724 T1200M probably damaging Het
Asb2 A T 12: 103,333,357 I272N probably damaging Het
Bicd2 T C 13: 49,378,308 L342P probably damaging Het
C1qtnf6 T A 15: 78,525,006 I214F probably damaging Het
Cdc42bpg T A 19: 6,314,504 H587Q probably benign Het
Cfap70 T A 14: 20,400,434 I1010F possibly damaging Het
Chd1 A T 17: 15,742,274 K764N possibly damaging Het
Cluh A G 11: 74,665,704 D956G possibly damaging Het
Ehbp1l1 T C 19: 5,720,702 D243G probably benign Het
Ercc4 T C 16: 13,122,113 V169A probably benign Het
Erich6 T C 3: 58,636,884 E94G probably benign Het
Fam109a A T 5: 121,853,273 T233S possibly damaging Het
Fam46a G C 9: 85,324,617 A376G possibly damaging Het
Fubp3 A G 2: 31,604,612 probably null Het
Gabbr1 C T 17: 37,069,413 T736I probably damaging Het
Gm14496 T A 2: 181,995,820 M229K possibly damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gspt1 T C 16: 11,222,657 T596A probably benign Het
Hist1h1e A G 13: 23,622,367 I44T probably damaging Het
Htr5b T A 1: 121,510,428 Y358F probably damaging Het
Il18r1 A T 1: 40,474,832 Y66F possibly damaging Het
Il18rap A G 1: 40,525,376 T189A probably damaging Het
Itgav G T 2: 83,794,983 A771S probably benign Het
Klf11 T C 12: 24,655,519 V324A possibly damaging Het
Krtap15 T C 16: 88,829,305 C87R probably benign Het
Lrmp G A 6: 145,158,698 G164R possibly damaging Het
Mapk8ip3 C T 17: 24,901,718 G807D probably benign Het
Mbd5 A G 2: 49,279,743 D1642G probably benign Het
Med15 G T 16: 17,671,643 Q356K unknown Het
Mmp3 A G 9: 7,446,937 Y39C probably damaging Het
Mon2 A G 10: 123,013,946 S1149P probably damaging Het
Msh3 A G 13: 92,286,004 I548T probably damaging Het
Noc2l T A 4: 156,239,216 V179E possibly damaging Het
Olfr1272 A T 2: 90,282,404 M57K probably damaging Het
Olfr195 T G 16: 59,149,321 M157R possibly damaging Het
Olfr488 G T 7: 108,255,218 Q307K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdhb10 A T 18: 37,413,026 Q385L possibly damaging Het
Pdzd2 T C 15: 12,592,243 K105R probably damaging Het
Pex1 A T 5: 3,618,875 D582V probably damaging Het
Pi4ka A G 16: 17,405,632 probably null Het
Pigw T C 11: 84,877,240 N421S probably benign Het
Plek T C 11: 16,994,739 K97R probably benign Het
R3hcc1l C T 19: 42,583,540 R753* probably null Het
R3hdml G A 2: 163,502,447 W252* probably null Het
Sgce G A 6: 4,691,615 T320I probably benign Het
Sidt2 A T 9: 45,943,690 C562* probably null Het
Skint8 T C 4: 111,939,520 C274R possibly damaging Het
Slc13a5 A T 11: 72,245,127 M529K probably damaging Het
Smg8 T G 11: 87,085,565 S397R possibly damaging Het
Spock3 G T 8: 63,113,556 R68L possibly damaging Het
Stau2 T A 1: 16,460,329 H122L unknown Het
Tert G A 13: 73,642,376 R858H probably damaging Het
Tgm3 G A 2: 130,048,291 R658Q probably benign Het
Tmc4 A G 7: 3,669,919 I455T probably benign Het
Tmtc4 G A 14: 122,978,181 P18S probably benign Het
Tnc A G 4: 63,972,722 I1641T probably damaging Het
Trav14-3 A T 14: 53,763,494 N54I probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc5c T A 3: 141,789,942 M524K probably benign Het
Unc93a A G 17: 13,116,284 F292L probably benign Het
Uso1 A G 5: 92,173,992 N248S possibly damaging Het
Usp5 A G 6: 124,826,318 L73P probably damaging Het
Utp20 T A 10: 88,762,935 I60F possibly damaging Het
Vmn2r94 T A 17: 18,243,620 I803F probably benign Het
Other mutations in Sept12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1521:Sept12 UTSW 16 4996476 missense probably damaging 1.00
R1542:Sept12 UTSW 16 4992295 missense probably benign 0.02
R1618:Sept12 UTSW 16 4996476 missense probably damaging 1.00
R1690:Sept12 UTSW 16 4988514 missense probably damaging 1.00
R1912:Sept12 UTSW 16 4988553 missense probably damaging 1.00
R2131:Sept12 UTSW 16 4991779 missense probably damaging 1.00
R2138:Sept12 UTSW 16 4992206 missense probably damaging 1.00
R4673:Sept12 UTSW 16 4991943 missense probably damaging 1.00
R5020:Sept12 UTSW 16 4993756 missense probably damaging 1.00
R5328:Sept12 UTSW 16 4993993 missense possibly damaging 0.96
R6063:Sept12 UTSW 16 4992263 missense probably damaging 1.00
R7104:Sept12 UTSW 16 4991993 missense probably damaging 1.00
R7142:Sept12 UTSW 16 4988362 missense unknown
R7382:Sept12 UTSW 16 4988482 missense probably damaging 1.00
R7560:Sept12 UTSW 16 4992191 missense possibly damaging 0.91
R7631:Sept12 UTSW 16 4996456 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTATGAGTTGTGTGATAAGAGCCG -3'
(R):5'- AGCCTGACCATTGAAGAACGAG -3'

Sequencing Primer
(F):5'- GTTTGCTGCCCAACTTGAC -3'
(R):5'- CATTGAAGAACGAGATGCCTTC -3'
Posted On2019-06-26