Incidental Mutation 'R7317:Olfr1272'
ID563446
Institutional Source Beutler Lab
Gene Symbol Olfr1272
Ensembl Gene ENSMUSG00000075061
Gene Nameolfactory receptor 1272
SynonymsGA_x6K02T2Q125-51636504-51635578, MOR227-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7317 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location90280263-90292841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90282404 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 57 (M57K)
Ref Sequence ENSEMBL: ENSMUSP00000150745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099750] [ENSMUST00000117141]
Predicted Effect probably damaging
Transcript: ENSMUST00000099750
AA Change: M57K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097339
Gene: ENSMUSG00000075061
AA Change: M57K

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 7.5e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.5e-5 PFAM
Pfam:7tm_1 39 285 1.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117141
AA Change: M57K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,263,647 V200A probably benign Het
Adam22 G A 5: 8,090,202 P832L probably benign Het
Adamts17 C T 7: 66,840,556 R129* probably null Het
Alg5 G T 3: 54,749,331 R321L probably benign Het
Amotl1 T A 9: 14,575,219 T460S probably benign Het
Ankrd50 T C 3: 38,483,183 E7G possibly damaging Het
Ap3b2 T C 7: 81,461,028 T1000A unknown Het
Arap2 G A 5: 62,649,724 T1200M probably damaging Het
Asb2 A T 12: 103,333,357 I272N probably damaging Het
Bicd2 T C 13: 49,378,308 L342P probably damaging Het
C1qtnf6 T A 15: 78,525,006 I214F probably damaging Het
Cdc42bpg T A 19: 6,314,504 H587Q probably benign Het
Cfap70 T A 14: 20,400,434 I1010F possibly damaging Het
Chd1 A T 17: 15,742,274 K764N possibly damaging Het
Cluh A G 11: 74,665,704 D956G possibly damaging Het
Ehbp1l1 T C 19: 5,720,702 D243G probably benign Het
Ercc4 T C 16: 13,122,113 V169A probably benign Het
Erich6 T C 3: 58,636,884 E94G probably benign Het
Fam109a A T 5: 121,853,273 T233S possibly damaging Het
Fam46a G C 9: 85,324,617 A376G possibly damaging Het
Fubp3 A G 2: 31,604,612 probably null Het
Gabbr1 C T 17: 37,069,413 T736I probably damaging Het
Gm14496 T A 2: 181,995,820 M229K possibly damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gspt1 T C 16: 11,222,657 T596A probably benign Het
Hist1h1e A G 13: 23,622,367 I44T probably damaging Het
Htr5b T A 1: 121,510,428 Y358F probably damaging Het
Il18r1 A T 1: 40,474,832 Y66F possibly damaging Het
Il18rap A G 1: 40,525,376 T189A probably damaging Het
Itgav G T 2: 83,794,983 A771S probably benign Het
Klf11 T C 12: 24,655,519 V324A possibly damaging Het
Krtap15 T C 16: 88,829,305 C87R probably benign Het
Lrmp G A 6: 145,158,698 G164R possibly damaging Het
Mapk8ip3 C T 17: 24,901,718 G807D probably benign Het
Mbd5 A G 2: 49,279,743 D1642G probably benign Het
Med15 G T 16: 17,671,643 Q356K unknown Het
Mmp3 A G 9: 7,446,937 Y39C probably damaging Het
Mon2 A G 10: 123,013,946 S1149P probably damaging Het
Msh3 A G 13: 92,286,004 I548T probably damaging Het
Noc2l T A 4: 156,239,216 V179E possibly damaging Het
Olfr195 T G 16: 59,149,321 M157R possibly damaging Het
Olfr488 G T 7: 108,255,218 Q307K probably benign Het
Oxa1l A T 14: 54,360,855 M1L probably benign Het
Pcdhb10 A T 18: 37,413,026 Q385L possibly damaging Het
Pdzd2 T C 15: 12,592,243 K105R probably damaging Het
Pex1 A T 5: 3,618,875 D582V probably damaging Het
Pi4ka A G 16: 17,405,632 probably null Het
Pigw T C 11: 84,877,240 N421S probably benign Het
Plek T C 11: 16,994,739 K97R probably benign Het
R3hcc1l C T 19: 42,583,540 R753* probably null Het
R3hdml G A 2: 163,502,447 W252* probably null Het
Sept12 T C 16: 4,991,735 K238E probably damaging Het
Sgce G A 6: 4,691,615 T320I probably benign Het
Sidt2 A T 9: 45,943,690 C562* probably null Het
Skint8 T C 4: 111,939,520 C274R possibly damaging Het
Slc13a5 A T 11: 72,245,127 M529K probably damaging Het
Smg8 T G 11: 87,085,565 S397R possibly damaging Het
Spock3 G T 8: 63,113,556 R68L possibly damaging Het
Stau2 T A 1: 16,460,329 H122L unknown Het
Tert G A 13: 73,642,376 R858H probably damaging Het
Tgm3 G A 2: 130,048,291 R658Q probably benign Het
Tmc4 A G 7: 3,669,919 I455T probably benign Het
Tmtc4 G A 14: 122,978,181 P18S probably benign Het
Tnc A G 4: 63,972,722 I1641T probably damaging Het
Trav14-3 A T 14: 53,763,494 N54I probably damaging Het
Ttll13 A C 7: 80,254,163 K280Q probably damaging Het
Unc5c T A 3: 141,789,942 M524K probably benign Het
Unc93a A G 17: 13,116,284 F292L probably benign Het
Uso1 A G 5: 92,173,992 N248S possibly damaging Het
Usp5 A G 6: 124,826,318 L73P probably damaging Het
Utp20 T A 10: 88,762,935 I60F possibly damaging Het
Vmn2r94 T A 17: 18,243,620 I803F probably benign Het
Other mutations in Olfr1272
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Olfr1272 APN 2 90282081 missense possibly damaging 0.55
IGL01824:Olfr1272 APN 2 90281919 missense probably damaging 1.00
IGL01951:Olfr1272 APN 2 90282007 missense probably damaging 1.00
IGL02473:Olfr1272 APN 2 90281696 missense probably null 1.00
IGL02494:Olfr1272 APN 2 90281951 missense probably benign 0.35
IGL03410:Olfr1272 APN 2 90282213 missense probably damaging 1.00
R0350:Olfr1272 UTSW 2 90282582 unclassified probably null
R0363:Olfr1272 UTSW 2 90281856 missense probably damaging 1.00
R0401:Olfr1272 UTSW 2 90282404 missense probably damaging 1.00
R0666:Olfr1272 UTSW 2 90281868 missense probably damaging 0.96
R1860:Olfr1272 UTSW 2 90282158 missense probably damaging 1.00
R1861:Olfr1272 UTSW 2 90282158 missense probably damaging 1.00
R2374:Olfr1272 UTSW 2 90282451 missense possibly damaging 0.76
R4256:Olfr1272 UTSW 2 90282062 missense probably damaging 1.00
R4737:Olfr1272 UTSW 2 90282381 missense probably damaging 1.00
R4827:Olfr1272 UTSW 2 90282203 missense probably damaging 1.00
R5198:Olfr1272 UTSW 2 90296393 missense probably damaging 1.00
R5589:Olfr1272 UTSW 2 90281969 missense probably damaging 1.00
R6412:Olfr1272 UTSW 2 90281858 missense probably damaging 1.00
R7130:Olfr1272 UTSW 2 90281922 missense probably benign
R7497:Olfr1272 UTSW 2 90281754 missense possibly damaging 0.74
R7762:Olfr1272 UTSW 2 90296631 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGGTTTGCAGATGGCCAC -3'
(R):5'- ACACGTGAATTGACTCCATGGC -3'

Sequencing Primer
(F):5'- TTTGCAGATGGCCACATAGC -3'
(R):5'- TGGCCAACAAAAATAATATAACCGAG -3'
Posted On2019-06-26