Incidental Mutation 'R0637:Gars'
Institutional Source Beutler Lab
Gene Symbol Gars
Ensembl Gene ENSMUSG00000029777
Gene Nameglycyl-tRNA synthetase
SynonymsGENA202, Sgrp23, Gena201
MMRRC Submission 038826-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0637 (G1)
Quality Score225
Status Validated
Chromosomal Location55038007-55079500 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 55069487 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003572]
Predicted Effect probably null
Transcript: ENSMUST00000003572
SMART Domains Protein: ENSMUSP00000003572
Gene: ENSMUSG00000029777

low complexity region 4 27 N/A INTRINSIC
low complexity region 31 46 N/A INTRINSIC
WHEP-TRS 57 112 1.58e-8 SMART
Pfam:tRNA-synt_2b 281 582 2.1e-10 PFAM
Pfam:HGTP_anticodon 605 699 7.7e-24 PFAM
Meta Mutation Damage Score 0.9594 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 94.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glycyl-tRNA synthetase, one of the aminoacyl-tRNA synthetases that charge tRNAs with their cognate amino acids. The encoded enzyme is an (alpha)2 dimer which belongs to the class II family of tRNA synthetases. It has been shown to be a target of autoantibodies in the human autoimmune diseases, polymyositis or dermatomyositis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: A dominant mutation results in sensory and motor axon degeneration in affected mice, with defects in synaptic transmission, nerve conduction and premature death. A loss of function mutation results in embryonic lethality in homozygous mice, and no discernable phenotype in heterozygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 C T 9: 53,587,531 D285N probably damaging Het
Aldh3a1 G A 11: 61,215,478 probably benign Het
Alms1 A G 6: 85,623,033 T2083A possibly damaging Het
Atrip C T 9: 109,061,173 M143I possibly damaging Het
Aup1 T A 6: 83,056,861 V344D probably damaging Het
Baiap2 G A 11: 120,000,579 V511M probably benign Het
Bnip2 T A 9: 70,003,673 probably null Het
Cacna1i A T 15: 80,372,654 Y1083F probably damaging Het
Cbr4 T C 8: 61,490,706 probably benign Het
Ces2b C T 8: 104,834,605 probably benign Het
Chd1 A G 17: 15,742,288 N769S possibly damaging Het
Clca3b A T 3: 144,827,940 V558D probably benign Het
Col12a1 T C 9: 79,656,735 D1736G probably benign Het
Cpne8 C A 15: 90,648,621 C61F probably damaging Het
Cxcr1 A G 1: 74,192,839 I8T probably benign Het
D630003M21Rik T G 2: 158,195,407 probably benign Het
Dcaf17 T A 2: 71,060,419 D99E probably damaging Het
Fam60a A G 6: 148,930,665 probably benign Het
Fbf1 C T 11: 116,160,054 probably benign Het
Fgfr2 T A 7: 130,171,624 H570L possibly damaging Het
Gm10309 A G 17: 86,499,035 probably benign Het
Gm13023 A T 4: 143,793,909 Y77F probably benign Het
Gm9892 G A 8: 52,196,825 Q78* probably null Het
Has1 A G 17: 17,843,863 Y505H possibly damaging Het
Hivep3 T A 4: 120,132,541 L2063* probably null Het
Itgb3 T C 11: 104,658,876 V614A probably benign Het
Lrrc23 A G 6: 124,778,358 probably benign Het
Lrrc63 A T 14: 75,098,220 probably benign Het
Mfhas1 C T 8: 35,590,026 R357* probably null Het
Mink1 C A 11: 70,601,676 N123K probably damaging Het
Mtmr4 A G 11: 87,611,064 H591R probably benign Het
Nav3 T C 10: 109,770,197 T923A probably benign Het
Ncapg A G 5: 45,687,324 T554A probably damaging Het
Nfe2l1 T C 11: 96,827,688 Y7C probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Obscn A T 11: 59,051,644 M4904K probably damaging Het
Obscn G T 11: 59,082,776 L1910I probably damaging Het
Olfr890 T C 9: 38,143,882 F244S probably benign Het
Pcdhb15 T A 18: 37,475,566 V617E probably damaging Het
Pelp1 T C 11: 70,395,704 T533A possibly damaging Het
Pgrmc1 T C X: 36,602,271 F160S probably damaging Het
Pink1 G T 4: 138,318,046 P239Q probably damaging Het
Prr27 A G 5: 87,851,146 probably benign Het
Rbpms G A 8: 33,806,836 P138S probably damaging Het
Rcc2 T C 4: 140,717,744 probably benign Het
Rgs3 T C 4: 62,646,673 probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo1 C T 16: 73,001,951 T933M probably benign Het
Steap4 T C 5: 7,978,398 probably benign Het
Tenm3 T C 8: 48,236,525 Y2009C probably damaging Het
Tnr A C 1: 159,850,335 T97P possibly damaging Het
Topaz1 T A 9: 122,791,477 L1320* probably null Het
Topaz1 A G 9: 122,797,662 M1452V probably benign Het
Trank1 T G 9: 111,390,441 F2082C probably damaging Het
Trim24 C A 6: 37,958,559 probably null Het
Tspoap1 T A 11: 87,777,240 probably benign Het
Ubr4 T C 4: 139,399,615 L483P probably damaging Het
Vmn2r2 T A 3: 64,126,578 T508S probably benign Het
Vps18 C T 2: 119,293,905 R438C probably damaging Het
Zfp366 C A 13: 99,228,966 R212S probably damaging Het
Zkscan4 T A 13: 21,481,307 C122S probably damaging Het
Other mutations in Gars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Gars APN 6 55050353 missense probably damaging 1.00
IGL01084:Gars APN 6 55055827 missense probably benign
IGL01514:Gars APN 6 55065520 missense probably benign 0.01
IGL02104:Gars APN 6 55077697 missense probably damaging 1.00
IGL02349:Gars APN 6 55048064 splice site probably benign
IGL02371:Gars APN 6 55065467 missense probably benign 0.08
IGL02932:Gars APN 6 55060944 missense probably damaging 1.00
IGL02799:Gars UTSW 6 55063099 missense probably damaging 1.00
R0762:Gars UTSW 6 55077580 splice site probably null
R1451:Gars UTSW 6 55053123 splice site probably benign
R1846:Gars UTSW 6 55063168 missense probably benign 0.05
R1988:Gars UTSW 6 55077772 missense probably null 0.00
R2033:Gars UTSW 6 55077723 missense probably benign 0.02
R2566:Gars UTSW 6 55065563 missense probably damaging 1.00
R4706:Gars UTSW 6 55069378 missense probably damaging 0.99
R4854:Gars UTSW 6 55046418 missense probably damaging 0.99
R5055:Gars UTSW 6 55068092 missense probably damaging 1.00
R5558:Gars UTSW 6 55065607 missense probably damaging 1.00
R6306:Gars UTSW 6 55055824 missense probably damaging 1.00
R6821:Gars UTSW 6 55079338 missense probably benign 0.00
R7376:Gars UTSW 6 55073359 missense probably benign 0.00
R7505:Gars UTSW 6 55052177 missense probably benign 0.00
R7579:Gars UTSW 6 55077703 missense probably damaging 1.00
R7605:Gars UTSW 6 55077750 missense probably damaging 1.00
R7728:Gars UTSW 6 55050386 missense probably damaging 1.00
R8014:Gars UTSW 6 55073407 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cacactatttggcactgaattttg -3'
Posted On2013-07-11