Incidental Mutation 'R6952:Abcf3'
ID568478
Institutional Source Beutler Lab
Gene Symbol Abcf3
Ensembl Gene ENSMUSG00000003234
Gene NameATP-binding cassette, sub-family F (GCN20), member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6952 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20548577-20561379 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 20549734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000156048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003319] [ENSMUST00000007216] [ENSMUST00000232490] [ENSMUST00000232680]
Predicted Effect probably null
Transcript: ENSMUST00000003319
SMART Domains Protein: ENSMUSP00000003319
Gene: ENSMUSG00000003234

DomainStartEndE-ValueType
low complexity region 120 137 N/A INTRINSIC
AAA 202 401 3.23e-11 SMART
low complexity region 423 435 N/A INTRINSIC
low complexity region 457 469 N/A INTRINSIC
AAA 517 684 4.68e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000007216
SMART Domains Protein: ENSMUSP00000007216
Gene: ENSMUSG00000022841

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 137 6.7e-8 PFAM
Pfam:Adap_comp_sub 159 435 3.2e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231258
Predicted Effect probably null
Transcript: ENSMUST00000232490
Predicted Effect probably null
Transcript: ENSMUST00000232680
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C A 11: 69,885,517 V219L probably benign Het
Arpp21 G A 9: 112,126,482 P530S probably damaging Het
Atp6v1b1 T C 6: 83,754,810 V224A probably damaging Het
Brd3 T C 2: 27,454,359 D453G probably damaging Het
Btbd10 A T 7: 113,351,943 probably null Het
Ccdc148 T C 2: 58,823,645 H498R probably damaging Het
Cga A T 4: 34,905,171 Y65F possibly damaging Het
Chd7 A T 4: 8,856,797 H136L probably damaging Het
Chit1 T C 1: 134,143,284 Y34H probably damaging Het
Dapk2 C G 9: 66,254,622 R271G probably benign Het
Dnhd1 T G 7: 105,713,688 V3819G probably damaging Het
Dsg3 A T 18: 20,525,159 I276F possibly damaging Het
Dusp1 T C 17: 26,507,603 S162G probably benign Het
Fam189a2 A T 19: 23,984,718 M307K possibly damaging Het
Gga2 C A 7: 121,998,888 A328S probably benign Het
Gpr183 A G 14: 121,954,485 I208T possibly damaging Het
Haspin T C 11: 73,136,145 D706G possibly damaging Het
Hdac5 T C 11: 102,204,960 I338V probably benign Het
Ik C T 18: 36,753,560 R362C probably damaging Het
Kdm4c T G 4: 74,357,350 C754W probably damaging Het
Lexm C G 4: 106,610,399 probably null Het
Limk1 T A 5: 134,670,478 I142F possibly damaging Het
Mccc2 T C 13: 99,967,726 E305G probably benign Het
Mdm1 A G 10: 118,168,057 D639G probably damaging Het
Mefv T G 16: 3,710,880 T566P probably damaging Het
Mep1b G A 18: 21,088,670 V226I probably benign Het
Mgmt T C 7: 136,951,335 M19T probably benign Het
Mrgpra6 A T 7: 47,185,945 S243T probably benign Het
Myh7 C T 14: 54,991,740 R169Q probably damaging Het
Myo1b T C 1: 51,762,509 I917V probably damaging Het
Olfr1253 A T 2: 89,752,627 M67K possibly damaging Het
Phlpp1 T C 1: 106,172,479 L159P probably benign Het
Plekhh3 T C 11: 101,165,656 E371G probably damaging Het
Rps6ka2 C A 17: 7,227,978 D21E probably benign Het
Slc47a1 T A 11: 61,344,454 M518L probably benign Het
Slitrk6 T C 14: 110,750,542 T578A probably benign Het
Syne2 A T 12: 75,927,431 K1133N possibly damaging Het
Taco1 T C 11: 106,073,116 S234P probably benign Het
Trpv4 G A 5: 114,633,202 S422F probably damaging Het
Tvp23b T A 11: 62,885,126 D97E possibly damaging Het
Vmn1r37 A T 6: 66,731,539 I13L probably benign Het
Vrk2 T A 11: 26,535,597 K130N probably damaging Het
Wdfy4 C T 14: 32,959,966 R3016Q probably damaging Het
Zfp383 T C 7: 29,914,955 S212P probably benign Het
Other mutations in Abcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Abcf3 APN 16 20551684 missense probably damaging 0.98
IGL01570:Abcf3 APN 16 20559998 missense probably damaging 1.00
IGL02239:Abcf3 APN 16 20550636 missense possibly damaging 0.85
R0158:Abcf3 UTSW 16 20552566 missense probably damaging 1.00
R0270:Abcf3 UTSW 16 20560168 splice site probably null
R0579:Abcf3 UTSW 16 20550648 missense probably benign
R0671:Abcf3 UTSW 16 20550487 missense probably damaging 1.00
R0799:Abcf3 UTSW 16 20559334 missense probably damaging 1.00
R1384:Abcf3 UTSW 16 20559303 missense probably damaging 1.00
R1393:Abcf3 UTSW 16 20560430 missense probably benign 0.01
R2356:Abcf3 UTSW 16 20560499 missense probably benign 0.01
R2910:Abcf3 UTSW 16 20560232 missense probably damaging 0.98
R2911:Abcf3 UTSW 16 20560232 missense probably damaging 0.98
R3081:Abcf3 UTSW 16 20559364 missense probably benign 0.09
R3852:Abcf3 UTSW 16 20560439 missense probably damaging 1.00
R4707:Abcf3 UTSW 16 20549058 missense possibly damaging 0.91
R4752:Abcf3 UTSW 16 20550576 missense probably damaging 1.00
R4885:Abcf3 UTSW 16 20551675 missense probably benign 0.05
R5672:Abcf3 UTSW 16 20549252 missense probably benign 0.00
R5817:Abcf3 UTSW 16 20549083 missense possibly damaging 0.95
R6013:Abcf3 UTSW 16 20550561 unclassified probably null
R6019:Abcf3 UTSW 16 20552451 missense possibly damaging 0.60
R6026:Abcf3 UTSW 16 20550570 missense probably damaging 1.00
R7327:Abcf3 UTSW 16 20548680 missense probably benign 0.03
R7431:Abcf3 UTSW 16 20558789 missense probably benign 0.00
R7539:Abcf3 UTSW 16 20552632 critical splice donor site probably null
R7764:Abcf3 UTSW 16 20549290 missense probably benign 0.36
X0066:Abcf3 UTSW 16 20559697 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CCTTAACCAACAGCGTGGTC -3'
(R):5'- AGGAACTCCAGAGATTACTGCAAAC -3'

Sequencing Primer
(F):5'- GGTCTTAAAAGAGTACATTGGGCTC -3'
(R):5'- ACTTACCCATGACGCTACATAAG -3'
Posted On2019-08-05