Incidental Mutation 'R7360:4922502D21Rik'
ID571262
Institutional Source Beutler Lab
Gene Symbol 4922502D21Rik
Ensembl Gene ENSMUSG00000047720
Gene NameRIKEN cDNA 4922502D21 gene
SynonymsLOC381816
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7360 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location129322164-129331796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 129326747 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 85 (R85H)
Ref Sequence ENSEMBL: ENSMUSP00000062024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051283]
Predicted Effect probably benign
Transcript: ENSMUST00000051283
AA Change: R85H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000062024
Gene: ENSMUSG00000047720
AA Change: R85H

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
CLECT 71 183 1.32e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203159
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,296,507 D223G unknown Het
Acot11 G C 4: 106,749,351 P534A possibly damaging Het
Arhgef26 T A 3: 62,448,205 Y733N possibly damaging Het
Aste1 G T 9: 105,397,636 M358I probably damaging Het
B4galnt3 C T 6: 120,232,979 W61* probably null Het
Brd9 C T 13: 73,944,823 R311W probably benign Het
Cdkn1c T C 7: 143,460,694 D5G possibly damaging Het
Cerk A G 15: 86,159,126 F158S probably damaging Het
Cnot4 T A 6: 35,065,006 E235V probably damaging Het
Crmp1 T C 5: 37,276,280 V275A possibly damaging Het
Dcbld2 C A 16: 58,465,320 probably null Het
Dip2a T C 10: 76,278,560 R1029G probably damaging Het
Dnaaf1 A G 8: 119,577,351 T43A probably benign Het
Eaf2 C T 16: 36,828,152 S2N probably benign Het
Eif2b4 T C 5: 31,191,375 D164G probably benign Het
Fpgs T C 2: 32,693,993 Y45C possibly damaging Het
Gm1527 C T 3: 28,914,542 Q248* probably null Het
Gm29666 C T 15: 84,914,268 A31T unknown Het
Gmip C A 8: 69,811,242 A112D probably damaging Het
Hibadh C T 6: 52,640,212 G13S probably benign Het
Hmcn1 A T 1: 150,618,846 V4164D probably damaging Het
Kif15 A T 9: 122,991,137 N580I probably benign Het
Krt25 G A 11: 99,317,406 T332M probably benign Het
Krt88 G T 15: 101,447,762 probably benign Het
Lrrk2 T C 15: 91,731,655 probably null Het
Mapkapk5 A G 5: 121,537,106 probably benign Het
Myh7b C T 2: 155,632,540 S1725L probably benign Het
Nckap1l T G 15: 103,476,099 probably null Het
Nphp3 A G 9: 104,016,078 probably null Het
Obscn A C 11: 59,082,359 V1996G probably damaging Het
Olfr1196 A T 2: 88,700,987 V114E probably damaging Het
Olfr761 T A 17: 37,953,009 N5I probably damaging Het
Parp8 T C 13: 116,895,771 T289A probably benign Het
Pcsk5 T C 19: 17,515,213 K932R probably benign Het
Pde4dip T C 3: 97,718,316 D1322G probably benign Het
Peli3 A T 19: 4,935,075 M136K possibly damaging Het
Pgm5 A G 19: 24,834,817 I117T probably damaging Het
Ppm1g T C 5: 31,203,277 D478G probably damaging Het
Ppp2r5c A G 12: 110,574,838 T474A probably benign Het
Ptger3 T C 3: 157,567,127 V37A probably benign Het
Ptprz1 T C 6: 23,000,907 S999P probably damaging Het
Pygl C T 12: 70,227,532 G18S probably benign Het
Rest T C 5: 77,281,129 V465A probably benign Het
Sart1 T C 19: 5,383,203 D422G probably damaging Het
Sgk1 A G 10: 21,994,073 M4V probably benign Het
Slc33a1 A G 3: 63,947,654 V395A possibly damaging Het
Slc38a11 A T 2: 65,353,795 S171T possibly damaging Het
Slc4a2 T A 5: 24,429,715 S76T probably benign Het
Ssc4d T A 5: 135,966,111 S184C probably damaging Het
Tspoap1 A G 11: 87,778,521 Y1540C probably benign Het
Ube3a T A 7: 59,276,635 L408Q probably damaging Het
Usp43 C A 11: 67,876,329 probably null Het
Zan A C 5: 137,386,970 V5067G unknown Het
Zfp180 C A 7: 24,105,490 L445I probably damaging Het
Other mutations in 4922502D21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:4922502D21Rik APN 6 129326762 missense probably benign 0.00
IGL02298:4922502D21Rik APN 6 129331564 start codon destroyed probably benign 0.09
IGL03350:4922502D21Rik APN 6 129331023 missense probably benign 0.07
R0178:4922502D21Rik UTSW 6 129326823 missense probably benign 0.01
R0270:4922502D21Rik UTSW 6 129325608 nonsense probably null
R0414:4922502D21Rik UTSW 6 129326850 unclassified probably benign
R0648:4922502D21Rik UTSW 6 129330969 missense probably benign 0.03
R1065:4922502D21Rik UTSW 6 129323050 missense possibly damaging 0.83
R2075:4922502D21Rik UTSW 6 129326703 missense probably benign 0.01
R6163:4922502D21Rik UTSW 6 129326747 missense probably benign 0.00
R7092:4922502D21Rik UTSW 6 129323000 missense probably benign 0.12
R7107:4922502D21Rik UTSW 6 129322952 missense probably damaging 1.00
R7369:4922502D21Rik UTSW 6 129331533 missense possibly damaging 0.68
R7414:4922502D21Rik UTSW 6 129325633 missense probably benign 0.17
R7937:4922502D21Rik UTSW 6 129331011 missense possibly damaging 0.84
R8345:4922502D21Rik UTSW 6 129325630 missense probably damaging 1.00
R8402:4922502D21Rik UTSW 6 129323044 missense possibly damaging 0.94
X0026:4922502D21Rik UTSW 6 129326693 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGAGCTTGTCTCCAATCTACC -3'
(R):5'- CGTTGGCCTTTCATCATGGAC -3'

Sequencing Primer
(F):5'- TCTACCTTGGAGAAGTGAGAAAATGC -3'
(R):5'- CATCATGGACTTGATGGCTAAAGTC -3'
Posted On2019-09-13