Incidental Mutation 'R0626:Numb'
ID57533
Institutional Source Beutler Lab
Gene Symbol Numb
Ensembl Gene ENSMUSG00000021224
Gene NameNUMB endocytic adaptor protein
Synonymsm-numb
MMRRC Submission 038815-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0626 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location83794034-83921934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83795840 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 510 (Y510H)
Ref Sequence ENSEMBL: ENSMUSP00000117899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000021647] [ENSMUST00000085215] [ENSMUST00000110298] [ENSMUST00000117217] [ENSMUST00000121733] [ENSMUST00000129335] [ENSMUST00000154043]
Predicted Effect probably benign
Transcript: ENSMUST00000021646
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000021647
AA Change: Y472H

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021647
Gene: ENSMUSG00000021224
AA Change: Y472H

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 339 4.7e-42 PFAM
low complexity region 413 434 N/A INTRINSIC
low complexity region 445 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085215
SMART Domains Protein: ENSMUSP00000082311
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 322 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110298
SMART Domains Protein: ENSMUSP00000105927
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
Pfam:PID 39 76 2.3e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117217
AA Change: Y461H

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113591
Gene: ENSMUSG00000021224
AA Change: Y461H

DomainStartEndE-ValueType
PTB 34 164 3.62e-38 SMART
low complexity region 220 242 N/A INTRINSIC
Pfam:NumbF 246 328 4.5e-42 PFAM
low complexity region 402 423 N/A INTRINSIC
low complexity region 434 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121733
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000129335
AA Change: Y521H

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119303
Gene: ENSMUSG00000021224
AA Change: Y521H

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 258 338 9.9e-32 PFAM
low complexity region 462 483 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154043
AA Change: Y510H

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117899
Gene: ENSMUSG00000021224
AA Change: Y510H

DomainStartEndE-ValueType
PTB 34 164 3.62e-38 SMART
low complexity region 220 242 N/A INTRINSIC
Pfam:NumbF 246 328 5.1e-42 PFAM
low complexity region 451 472 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.9%
  • 20x: 96.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a conserved protein that is distributed asymmetrically during cell division in the developing embryo. The encoded protein participates in cell fate decisions by interacting with the Notch receptor. Loss of function of this gene results in severe defects in neural development and loss of viability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele die at ~E11.5 with neural tube closure defects and precocious cortical neurogenesis. Mice homozygous for another null allele show impaired axial rotation, neural tube closure, angiogenic remodeling, placenta formation, and motor and sensory neuron differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik T C 11: 109,788,721 probably benign Het
6430571L13Rik T A 9: 107,342,508 D53E possibly damaging Het
A2ml1 T A 6: 128,550,773 N1018I probably damaging Het
Abi3 C A 11: 95,837,111 A85S probably benign Het
Acsl5 A T 19: 55,284,472 M340L probably benign Het
Adam29 T A 8: 55,871,577 H614L probably benign Het
Adgrg6 A T 10: 14,436,884 S720T probably damaging Het
Adrb2 G T 18: 62,179,370 A128E probably damaging Het
Afap1l1 T C 18: 61,739,220 E510G probably benign Het
Angel1 A G 12: 86,717,713 probably null Het
Aox3 T G 1: 58,172,299 I1005S possibly damaging Het
Apc C A 18: 34,318,454 P2767Q probably damaging Het
Apob T G 12: 8,016,193 D4387E probably benign Het
Apobr T C 7: 126,586,655 V446A possibly damaging Het
Arhgap28 A T 17: 67,896,113 probably null Het
Aspm G T 1: 139,491,601 K3001N probably damaging Het
Asxl3 G T 18: 22,522,880 V1316F probably benign Het
Atp2a1 T A 7: 126,446,990 probably null Het
Bach1 A G 16: 87,729,471 D607G possibly damaging Het
Batf3 A G 1: 191,100,738 D27G probably damaging Het
Baz1a G T 12: 54,975,270 Q76K probably damaging Het
Bdnf G A 2: 109,723,538 V86M probably benign Het
Birc7 A G 2: 180,931,305 I172V probably benign Het
Bod1l A C 5: 41,831,537 V409G probably damaging Het
Cacna1e T A 1: 154,488,817 E337V probably damaging Het
Cacna1h A G 17: 25,393,546 F287L possibly damaging Het
Ces1e A G 8: 93,224,043 Y37H probably benign Het
Clasrp A T 7: 19,584,493 probably benign Het
Clec2d T A 6: 129,183,127 S35T probably damaging Het
Cntn4 T A 6: 106,662,578 D556E probably benign Het
Cntnap5c A T 17: 58,042,427 D245V probably benign Het
Col5a1 T A 2: 27,928,243 L160* probably null Het
Col6a6 T C 9: 105,777,744 E926G probably benign Het
Cpsf2 T A 12: 101,985,231 H142Q probably benign Het
Cr2 A C 1: 195,171,111 S20A possibly damaging Het
Cyp2j5 A T 4: 96,659,512 H164Q probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmbt1 G A 7: 131,102,081 V1124M probably damaging Het
Dmxl2 T C 9: 54,416,554 H1182R probably damaging Het
Dnah2 A T 11: 69,477,683 S1709T probably benign Het
Dopey2 T C 16: 93,763,956 V776A probably damaging Het
Emc3 T C 6: 113,516,031 T220A probably benign Het
Entpd1 A C 19: 40,727,325 N312T probably benign Het
Fam8a1 A T 13: 46,671,223 I229F probably damaging Het
Fancc G A 13: 63,317,391 P501S probably damaging Het
Fasn T C 11: 120,811,925 R1704G probably damaging Het
Fsip2 A G 2: 82,988,958 I5012V probably benign Het
Glce T C 9: 62,061,000 T290A probably benign Het
Gm648 G A X: 56,545,039 P134L probably benign Het
Gns G A 10: 121,383,444 probably null Het
Gsdma2 A G 11: 98,651,984 N190S probably damaging Het
Hectd4 T A 5: 121,277,824 S563T probably benign Het
Hmcn1 T C 1: 150,798,719 probably null Het
Jup A T 11: 100,376,763 M578K probably benign Het
Kir3dl1 G A X: 136,533,845 probably null Het
Krt75 A G 15: 101,573,590 F81S probably benign Het
Lrp1 G T 10: 127,567,364 D2113E probably damaging Het
Maged2 T A X: 150,811,834 N176Y probably damaging Het
Mrc1 T A 2: 14,328,571 C1354* probably null Het
Mup7 A C 4: 60,069,742 V74G possibly damaging Het
Naca A G 10: 128,041,162 probably benign Het
Nav3 T G 10: 109,823,464 Y764S probably damaging Het
Nkpd1 A T 7: 19,523,174 T293S probably benign Het
Nynrin T G 14: 55,868,035 L834R probably damaging Het
Olfr1537 T A 9: 39,237,866 N186I possibly damaging Het
Olfr318 G T 11: 58,720,521 H176N probably benign Het
Olfr743 T C 14: 50,533,702 S97P possibly damaging Het
Otog T C 7: 46,271,373 V1000A possibly damaging Het
Pafah1b3 A G 7: 25,297,129 V43A possibly damaging Het
Pcnx A G 12: 81,983,676 Y1775C possibly damaging Het
Phka1 G A X: 102,520,831 R1074C probably damaging Het
Pi4ka T A 16: 17,293,901 Y1570F probably benign Het
Piezo2 T C 18: 63,019,258 K2588E probably damaging Het
Pkd1 A G 17: 24,575,575 T2079A probably damaging Het
Plekhd1 G T 12: 80,717,301 Q212H probably damaging Het
Plekhh1 C T 12: 79,040,585 R16* probably null Het
Polm C A 11: 5,836,207 R120L probably damaging Het
Ptpn22 T C 3: 103,860,405 M1T probably null Het
Ptprh G A 7: 4,564,272 L534F probably benign Het
Rabl6 C T 2: 25,592,766 probably null Het
Rap2a A G 14: 120,478,991 S89G probably damaging Het
Rara A T 11: 98,971,580 probably null Het
Reck A G 4: 43,930,295 D623G probably benign Het
Relt A T 7: 100,848,816 L237Q probably damaging Het
Rngtt A G 4: 33,329,598 probably null Het
Rtn4rl2 T G 2: 84,880,419 Y167S probably damaging Het
Sec24c C T 14: 20,688,437 R353C probably damaging Het
Slc35g2 T C 9: 100,553,442 S59G probably benign Het
Smarcd2 A T 11: 106,267,415 M107K probably benign Het
Smg1 T C 7: 118,182,383 N1227S possibly damaging Het
Snrnp200 A G 2: 127,221,814 N638D possibly damaging Het
Sntb1 A G 15: 55,642,783 S465P probably benign Het
Sp4 A G 12: 118,299,579 L244P probably damaging Het
Sulf1 A G 1: 12,817,492 probably null Het
Tbc1d17 T C 7: 44,843,085 T385A probably benign Het
Tbx10 C A 19: 3,997,873 D206E probably benign Het
Tcea2 C T 2: 181,687,638 P275S probably damaging Het
Tns3 C A 11: 8,493,121 R414L probably benign Het
Trip11 T C 12: 101,885,976 R610G possibly damaging Het
Ugt2b1 T C 5: 86,925,861 K213R probably null Het
Unc80 A G 1: 66,608,442 S1514G probably benign Het
Usp7 G T 16: 8,693,914 Q867K possibly damaging Het
Vim T C 2: 13,574,652 V74A probably benign Het
Vmn1r234 A G 17: 21,229,745 Y307C probably benign Het
Vmn2r74 A T 7: 85,961,309 Y58* probably null Het
Wdr36 C A 18: 32,850,531 A445E probably damaging Het
Xpo5 T A 17: 46,221,433 W465R probably damaging Het
Zscan4d T A 7: 11,165,019 R110S probably damaging Het
Other mutations in Numb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Numb APN 12 83808132 missense probably damaging 1.00
IGL01979:Numb APN 12 83842277 missense probably damaging 1.00
IGL02318:Numb APN 12 83831918 intron probably null
IGL02716:Numb APN 12 83801208 missense possibly damaging 0.79
IGL03206:Numb APN 12 83825296 splice site probably benign
PIT4468001:Numb UTSW 12 83808147 missense probably damaging 0.99
R0086:Numb UTSW 12 83795930 missense probably damaging 1.00
R0652:Numb UTSW 12 83795792 missense probably damaging 1.00
R1201:Numb UTSW 12 83801285 missense probably damaging 0.99
R1295:Numb UTSW 12 83796161 splice site probably benign
R1433:Numb UTSW 12 83797259 missense probably damaging 0.98
R1489:Numb UTSW 12 83795443 missense probably damaging 1.00
R1606:Numb UTSW 12 83801010 splice site probably null
R1980:Numb UTSW 12 83797344 critical splice acceptor site probably null
R3771:Numb UTSW 12 83799576 missense probably damaging 0.99
R5382:Numb UTSW 12 83808205 missense probably damaging 1.00
R5818:Numb UTSW 12 83825254 splice site probably null
R5846:Numb UTSW 12 83876747 utr 5 prime probably benign
R6360:Numb UTSW 12 83797262 missense probably damaging 0.99
R6384:Numb UTSW 12 83803974 missense probably damaging 1.00
R7186:Numb UTSW 12 83796146 missense probably damaging 1.00
R7469:Numb UTSW 12 83803804 missense probably benign 0.37
R7749:Numb UTSW 12 83801277 missense not run
Predicted Primers PCR Primer
(F):5'- AGGGACTGGTGGTAGCACTACTTG -3'
(R):5'- AGCCTCCACATGCCTTCAGATGAC -3'

Sequencing Primer
(F):5'- AGCACTACTTGTCTCATATTGAGGG -3'
(R):5'- TGACATCGTGCTCTAACAGG -3'
Posted On2013-07-11