Incidental Mutation 'R1489:Numb'
ID163616
Institutional Source Beutler Lab
Gene Symbol Numb
Ensembl Gene ENSMUSG00000021224
Gene NameNUMB endocytic adaptor protein
Synonymsm-numb
MMRRC Submission 039541-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1489 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location83794034-83921934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83795443 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 642 (L642P)
Ref Sequence ENSEMBL: ENSMUSP00000117899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021646] [ENSMUST00000021647] [ENSMUST00000085215] [ENSMUST00000110298] [ENSMUST00000117217] [ENSMUST00000121733] [ENSMUST00000129335] [ENSMUST00000154043]
Predicted Effect probably benign
Transcript: ENSMUST00000021646
SMART Domains Protein: ENSMUSP00000021646
Gene: ENSMUSG00000021223

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 3.3e-39 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 366 426 2.76e-7 SMART
TSP1 427 482 1.42e-9 SMART
TSP1 488 540 2.47e-9 SMART
low complexity region 604 621 N/A INTRINSIC
KU 748 801 1.83e-22 SMART
low complexity region 822 831 N/A INTRINSIC
IGc2 917 980 2.88e-4 SMART
IGc2 1056 1119 2.66e-17 SMART
IGc2 1145 1209 2.13e-7 SMART
Pfam:PLAC 1234 1268 2.3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021647
AA Change: L604P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021647
Gene: ENSMUSG00000021224
AA Change: L604P

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 339 4.7e-42 PFAM
low complexity region 413 434 N/A INTRINSIC
low complexity region 445 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085215
SMART Domains Protein: ENSMUSP00000082311
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 257 322 5.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110298
SMART Domains Protein: ENSMUSP00000105927
Gene: ENSMUSG00000021224

DomainStartEndE-ValueType
Pfam:PID 39 76 2.3e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117217
AA Change: L593P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113591
Gene: ENSMUSG00000021224
AA Change: L593P

DomainStartEndE-ValueType
PTB 34 164 3.62e-38 SMART
low complexity region 220 242 N/A INTRINSIC
Pfam:NumbF 246 328 4.5e-42 PFAM
low complexity region 402 423 N/A INTRINSIC
low complexity region 434 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121733
SMART Domains Protein: ENSMUSP00000113806
Gene: ENSMUSG00000021223

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
TSP1 30 81 3.36e-11 SMART
low complexity region 147 161 N/A INTRINSIC
Pfam:ADAM_spacer1 184 299 2.8e-38 PFAM
TSP1 309 362 1.2e-7 SMART
TSP1 388 448 1.82e-7 SMART
TSP1 449 504 1.42e-9 SMART
TSP1 510 562 2.47e-9 SMART
low complexity region 626 643 N/A INTRINSIC
KU 770 823 1.83e-22 SMART
Pfam:Papilin_u7 831 922 1.9e-40 PFAM
IGc2 939 1002 2.88e-4 SMART
IGc2 1078 1141 2.66e-17 SMART
IGc2 1167 1231 2.13e-7 SMART
Pfam:PLAC 1257 1289 1.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129335
AA Change: L653P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119303
Gene: ENSMUSG00000021224
AA Change: L653P

DomainStartEndE-ValueType
PTB 34 175 2.19e-37 SMART
low complexity region 231 253 N/A INTRINSIC
Pfam:NumbF 258 338 9.9e-32 PFAM
low complexity region 462 483 N/A INTRINSIC
low complexity region 494 502 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154043
AA Change: L642P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117899
Gene: ENSMUSG00000021224
AA Change: L642P

DomainStartEndE-ValueType
PTB 34 164 3.62e-38 SMART
low complexity region 220 242 N/A INTRINSIC
Pfam:NumbF 246 328 5.1e-42 PFAM
low complexity region 451 472 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
Meta Mutation Damage Score 0.6500 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (52/54)
MGI Phenotype FUNCTION: This gene encodes a conserved protein that is distributed asymmetrically during cell division in the developing embryo. The encoded protein participates in cell fate decisions by interacting with the Notch receptor. Loss of function of this gene results in severe defects in neural development and loss of viability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a null allele die at ~E11.5 with neural tube closure defects and precocious cortical neurogenesis. Mice homozygous for another null allele show impaired axial rotation, neural tube closure, angiogenic remodeling, placenta formation, and motor and sensory neuron differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700097O09Rik A G 12: 55,059,510 S143P possibly damaging Het
4930522H14Rik T C 4: 109,505,457 K218E possibly damaging Het
Abcb1a T A 5: 8,686,300 probably null Het
Adam39 A G 8: 40,824,994 T141A possibly damaging Het
Adam6b T A 12: 113,491,451 S629R probably benign Het
Ap3b2 C A 7: 81,463,690 E924* probably null Het
Armc3 A T 2: 19,310,047 Y856F probably benign Het
Asap1 A G 15: 64,172,730 L142P probably damaging Het
Atg9a T A 1: 75,186,090 D427V probably damaging Het
Atl2 G A 17: 79,852,706 A17V probably benign Het
Atxn2l A T 7: 126,496,467 S379T probably damaging Het
C1ql3 G T 2: 13,010,642 P69Q possibly damaging Het
Cap2 A T 13: 46,609,635 I114F probably damaging Het
Cox16 T C 12: 81,474,615 N135S probably null Het
Dnajc13 A T 9: 104,231,035 H180Q possibly damaging Het
Dpy19l3 A T 7: 35,725,410 Y73* probably null Het
Duox2 T A 2: 122,293,396 M436L probably benign Het
Exoc6 T A 19: 37,597,120 M481K possibly damaging Het
Fbxw2 GCCCCC GCCCCCCCC 2: 34,812,817 probably benign Het
Fmn1 T A 2: 113,365,212 V419E unknown Het
Fndc4 T C 5: 31,293,451 *232W probably null Het
Foxc1 C T 13: 31,808,612 R469* probably null Het
Fsip2 A G 2: 82,979,811 H2158R probably benign Het
Ghdc C T 11: 100,768,257 G373D probably benign Het
Gm10330 A T 12: 23,780,031 S50T probably benign Het
Gm8251 A G 1: 44,057,790 F1383L probably benign Het
Gm8251 T C 1: 44,061,507 I144V probably benign Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Lonrf1 A G 8: 36,222,954 V650A probably damaging Het
Map1a T C 2: 121,300,437 V578A possibly damaging Het
Mbd3 C G 10: 80,393,906 D190H probably damaging Het
Mcpt9 T C 14: 56,027,519 K175R probably benign Het
Mia3 A G 1: 183,338,674 S85P probably benign Het
Myrip T C 9: 120,432,529 F403L probably damaging Het
Nox4 A G 7: 87,304,889 Y134C probably damaging Het
Pappa A T 4: 65,180,948 Y568F possibly damaging Het
Pdzrn4 T C 15: 92,677,712 L333P probably benign Het
Prl A T 13: 27,057,636 S3C probably damaging Het
Ptprc T C 1: 138,120,086 T60A possibly damaging Het
Rbm10 C T X: 20,637,664 probably benign Het
Slc7a7 C T 14: 54,408,646 R120H probably damaging Het
Smpd1 T C 7: 105,556,554 probably null Het
Spta1 A G 1: 174,231,325 E1942G probably damaging Het
Tmem38a A G 8: 72,579,635 Y66C probably damaging Het
Tnnt1 A T 7: 4,507,525 Y232* probably null Het
Tpte T C 8: 22,349,389 probably null Het
Virma T C 4: 11,521,164 V907A probably damaging Het
Vmn1r174 C T 7: 23,754,556 Q216* probably null Het
Zswim3 T C 2: 164,819,981 V127A probably benign Het
Other mutations in Numb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Numb APN 12 83808132 missense probably damaging 1.00
IGL01979:Numb APN 12 83842277 missense probably damaging 1.00
IGL02318:Numb APN 12 83831918 intron probably null
IGL02716:Numb APN 12 83801208 missense possibly damaging 0.79
IGL03206:Numb APN 12 83825296 splice site probably benign
PIT4468001:Numb UTSW 12 83808147 missense probably damaging 0.99
R0086:Numb UTSW 12 83795930 missense probably damaging 1.00
R0626:Numb UTSW 12 83795840 missense probably damaging 0.97
R0652:Numb UTSW 12 83795792 missense probably damaging 1.00
R1201:Numb UTSW 12 83801285 missense probably damaging 0.99
R1295:Numb UTSW 12 83796161 splice site probably benign
R1433:Numb UTSW 12 83797259 missense probably damaging 0.98
R1606:Numb UTSW 12 83801010 splice site probably null
R1980:Numb UTSW 12 83797344 critical splice acceptor site probably null
R3771:Numb UTSW 12 83799576 missense probably damaging 0.99
R5382:Numb UTSW 12 83808205 missense probably damaging 1.00
R5818:Numb UTSW 12 83825254 splice site probably null
R5846:Numb UTSW 12 83876747 utr 5 prime probably benign
R6360:Numb UTSW 12 83797262 missense probably damaging 0.99
R6384:Numb UTSW 12 83803974 missense probably damaging 1.00
R7186:Numb UTSW 12 83796146 missense probably damaging 1.00
R7469:Numb UTSW 12 83803804 missense probably benign 0.37
R7749:Numb UTSW 12 83801277 missense not run
Predicted Primers PCR Primer
(F):5'- TGGAAGCTCAGCTTTATCCCCAGAC -3'
(R):5'- TGCTCAGCACCTCAATGGTTCTGC -3'

Sequencing Primer
(F):5'- ATTGCTAAGACAGCCCAGG -3'
(R):5'- CAGCTTTCAATGGTGTAGACAATGG -3'
Posted On2014-03-28