Incidental Mutation 'R7434:Tas2r113'
ID576626
Institutional Source Beutler Lab
Gene Symbol Tas2r113
Ensembl Gene ENSMUSG00000056926
Gene Nametaste receptor, type 2, member 113
SynonymsT2R13, mGR13, mt2r58, Tas2r13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7434 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location132893011-132893940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132893309 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 100 (T100I)
Ref Sequence ENSEMBL: ENSMUSP00000078044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079035]
Predicted Effect probably benign
Transcript: ENSMUST00000079035
AA Change: T100I

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000078044
Gene: ENSMUSG00000056926
AA Change: T100I

DomainStartEndE-ValueType
Pfam:TAS2R 1 301 9.4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430419D17Rik C T 7: 131,279,483 S1828F unknown Het
Adamtsl1 T C 4: 86,425,878 V1731A probably damaging Het
BC025446 T C 15: 75,216,718 F12L probably benign Het
Bcat2 A G 7: 45,576,005 probably null Het
Bcl6 T G 16: 23,970,048 E523D possibly damaging Het
Col4a2 T A 8: 11,421,250 N503K probably damaging Het
Cyb5r1 G A 1: 134,407,838 C166Y probably benign Het
Cyp2w1 T C 5: 139,357,020 V490A possibly damaging Het
Erich6b A G 14: 75,663,584 I113V probably benign Het
Fabp12 C T 3: 10,247,678 V95I probably benign Het
Fam198b T A 3: 79,941,362 F472I probably damaging Het
Gpr3 T C 4: 133,211,137 M75V probably benign Het
Grm5 T G 7: 88,130,474 S1073A probably benign Het
Hoxc9 A G 15: 102,983,982 K209R probably damaging Het
Irgm2 T G 11: 58,219,465 V6G probably benign Het
Jakmip2 A G 18: 43,557,379 V627A possibly damaging Het
Kansl1l C G 1: 66,762,103 S568T probably damaging Het
Lims1 A G 10: 58,394,479 T21A probably benign Het
Lpar2 G T 8: 69,826,515 A320S probably benign Het
Lpcat4 A G 2: 112,243,055 N235S probably damaging Het
Meis1 A T 11: 18,885,542 S359T unknown Het
Mtor C T 4: 148,464,959 T600I probably benign Het
Ncbp1 T C 4: 46,149,910 S144P probably damaging Het
Ncor1 T C 11: 62,383,199 E205G probably damaging Het
Nid1 T C 13: 13,468,464 I329T probably benign Het
Nos3 T C 5: 24,382,635 I1031T probably damaging Het
Nyap1 A G 5: 137,736,268 S168P probably damaging Het
Olfr684 A G 7: 105,156,899 V261A probably damaging Het
Pam T A 1: 97,975,790 K73* probably null Het
Pcdhga11 T C 18: 37,757,952 V671A probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Ric1 A G 19: 29,574,780 D317G probably damaging Het
Scn1a T C 2: 66,273,045 E1957G probably benign Het
Srcap T C 7: 127,560,242 S3097P unknown Het
Tnni1 A G 1: 135,807,522 D57G Het
Trim29 G A 9: 43,335,131 V575I probably damaging Het
Trpv3 G A 11: 73,288,261 V499M probably damaging Het
Ubr1 C T 2: 120,862,680 M1748I probably benign Het
Upk1a A T 7: 30,607,192 M99K probably damaging Het
Usp16 T A 16: 87,479,319 L515* probably null Het
Vmn1r103 T C 7: 20,510,510 K9E probably damaging Het
Vwde A G 6: 13,187,640 V616A probably benign Het
Zfp101 A T 17: 33,381,590 S397R possibly damaging Het
Other mutations in Tas2r113
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Tas2r113 APN 6 132893152 missense probably benign 0.01
IGL01118:Tas2r113 APN 6 132893315 missense probably benign 0.00
IGL01366:Tas2r113 APN 6 132893797 missense probably benign 0.06
IGL01955:Tas2r113 APN 6 132893854 missense probably benign
IGL02629:Tas2r113 APN 6 132893336 missense probably damaging 1.00
IGL02681:Tas2r113 APN 6 132893367 missense probably damaging 1.00
IGL02883:Tas2r113 APN 6 132893419 missense probably damaging 1.00
R0002:Tas2r113 UTSW 6 132893779 missense probably benign 0.21
R0309:Tas2r113 UTSW 6 132893378 missense probably damaging 1.00
R1700:Tas2r113 UTSW 6 132893792 missense possibly damaging 0.92
R1748:Tas2r113 UTSW 6 132893732 missense probably damaging 0.98
R1854:Tas2r113 UTSW 6 132893329 missense probably damaging 1.00
R1974:Tas2r113 UTSW 6 132893833 missense probably benign 0.00
R4697:Tas2r113 UTSW 6 132893516 missense probably benign 0.04
R4798:Tas2r113 UTSW 6 132893707 missense possibly damaging 0.69
R4816:Tas2r113 UTSW 6 132893782 missense probably benign 0.09
R4906:Tas2r113 UTSW 6 132893558 missense possibly damaging 0.69
R6005:Tas2r113 UTSW 6 132893696 missense probably benign 0.02
R6012:Tas2r113 UTSW 6 132893681 missense probably damaging 1.00
R6107:Tas2r113 UTSW 6 132893014 missense probably damaging 1.00
R6603:Tas2r113 UTSW 6 132893458 missense probably benign 0.01
R7263:Tas2r113 UTSW 6 132893576 missense possibly damaging 0.90
R7759:Tas2r113 UTSW 6 132893927 missense possibly damaging 0.85
X0022:Tas2r113 UTSW 6 132893296 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTGCATAGACTGGGTCCAAAG -3'
(R):5'- TACCGTGGACATAACAAAAGGTATG -3'

Sequencing Primer
(F):5'- CTGGGTCCAAAGAAGAAAAATCTC -3'
(R):5'- TGAGACACATTTCTTTGAACACTATC -3'
Posted On2019-10-07