Incidental Mutation 'R7470:Olfr148'
ID579123
Institutional Source Beutler Lab
Gene Symbol Olfr148
Ensembl Gene ENSMUSG00000048299
Gene Nameolfactory receptor 148
SynonymsMOR224-4, GA_x6K02T2PVTD-33310486-33311418, M30
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7470 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39610655-39615927 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 39613702 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 45 (T45K)
Ref Sequence ENSEMBL: ENSMUSP00000150761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050807] [ENSMUST00000216801]
Predicted Effect probably benign
Transcript: ENSMUST00000050807
AA Change: T45K

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096473
Gene: ENSMUSG00000048299
AA Change: T45K

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 8.4e-46 PFAM
Pfam:7TM_GPCR_Srsx 33 301 5.8e-6 PFAM
Pfam:7tm_1 39 287 4.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216801
AA Change: T45K

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,991,338 V238E possibly damaging Het
Actn3 G A 19: 4,867,814 S375L possibly damaging Het
Adgrg6 T C 10: 14,444,066 T476A probably benign Het
Afm T A 5: 90,531,627 S327T probably damaging Het
Apol7e T A 15: 77,717,943 M247K probably benign Het
Aqp12 T A 1: 93,008,663 L237Q probably damaging Het
Arhgef12 A T 9: 43,040,552 S63T probably damaging Het
Axdnd1 T A 1: 156,376,516 E393V Het
Cacna1g T A 11: 94,461,939 D365V possibly damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Ccr7 C T 11: 99,145,557 V180M possibly damaging Het
Cd47 T A 16: 49,884,222 I119K Het
Cenpe A T 3: 135,242,155 L1158F probably damaging Het
Cfi A G 3: 129,855,087 R207G probably benign Het
Cyp2j6 T C 4: 96,535,471 Y220C probably benign Het
Ddhd2 A G 8: 25,735,060 F577L probably benign Het
Dhx40 T C 11: 86,776,702 E537G probably damaging Het
Disp3 A T 4: 148,261,070 C438S possibly damaging Het
Dock3 A G 9: 107,005,445 S380P probably damaging Het
Ehmt2 A G 17: 34,899,396 E106G possibly damaging Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Gm11554 A C 11: 99,804,364 S8A unknown Het
Gm9268 T A 7: 43,047,886 M789K probably damaging Het
Grm7 A G 6: 111,501,515 I54V Het
Hbs1l T C 10: 21,358,784 F579L possibly damaging Het
Hgf C A 5: 16,618,856 Q684K probably benign Het
Igsf3 T C 3: 101,451,075 Y741H possibly damaging Het
Il17rb C A 14: 29,998,033 G304W probably damaging Het
Ino80c C T 18: 24,108,838 W163* probably null Het
Kcnt1 A C 2: 25,909,833 D997A probably damaging Het
Klf7 C T 1: 64,042,313 probably null Het
Lingo1 T C 9: 56,620,624 Y233C probably damaging Het
Lmo7 C A 14: 101,900,604 T914K possibly damaging Het
Mark1 G T 1: 184,928,044 Y138* probably null Het
Mcm3ap C A 10: 76,508,397 T1791K probably damaging Het
Mcts2 T C 2: 152,687,662 I131T probably benign Het
Mipep A G 14: 60,802,895 D288G probably benign Het
Ms4a8a T A 19: 11,076,350 N131Y possibly damaging Het
Nalcn T C 14: 123,572,044 E232G probably benign Het
Nat10 C T 2: 103,734,881 A452T probably benign Het
Nfatc2 G A 2: 168,523,307 Q596* probably null Het
Nudt13 G T 14: 20,309,723 G173W probably damaging Het
Olfr1 T A 11: 73,395,888 I45F probably damaging Het
Olfr1157 A T 2: 87,962,449 C148S possibly damaging Het
Olfr878 T A 9: 37,919,296 I213N probably damaging Het
Otud4 T C 8: 79,673,360 V901A probably benign Het
Pah G A 10: 87,563,424 R155Q probably damaging Het
Pkd1l3 A G 8: 109,638,376 H1130R probably benign Het
Pnliprp1 A G 19: 58,732,025 N111S possibly damaging Het
Ppp1r21 T C 17: 88,562,221 Y401H probably damaging Het
Prr14 A G 7: 127,475,825 K466R probably null Het
Ralgapa2 A G 2: 146,424,667 L663P probably damaging Het
Reg3d A T 6: 78,376,088 C171S possibly damaging Het
Reln G T 5: 21,942,741 L2404I probably damaging Het
Rnasel A C 1: 153,754,031 I98L probably benign Het
Rnf216 T C 5: 142,992,725 D886G possibly damaging Het
Rp1l1 A G 14: 64,028,566 R534G probably benign Het
Selenon A C 4: 134,539,750 S514A probably benign Het
Sema3d T A 5: 12,508,185 I228N probably damaging Het
Serpinb9g T A 13: 33,486,634 I35N probably damaging Het
Siglec1 A C 2: 131,075,824 H1044Q probably benign Het
Skint5 T A 4: 113,756,931 I693F unknown Het
Skint5 G T 4: 113,885,803 L370M unknown Het
Slc12a1 G A 2: 125,217,895 W905* probably null Het
Slc26a9 G C 1: 131,764,043 V675L probably benign Het
Slc5a7 A T 17: 54,276,962 Y433* probably null Het
Slc7a4 A G 16: 17,575,113 I274T probably benign Het
Slmap A G 14: 26,427,420 V612A probably benign Het
Spen T C 4: 141,479,294 D674G unknown Het
Ssh1 T C 5: 113,942,427 T981A possibly damaging Het
Sycp2l T C 13: 41,163,104 S180P probably benign Het
Tdrd7 C A 4: 45,990,144 S181R probably benign Het
Thada T C 17: 84,226,041 N1661D probably benign Het
Tsga13 C A 6: 30,900,046 D179Y possibly damaging Het
Ttf2 T G 3: 100,963,162 Q198H possibly damaging Het
Ugt2b37 T G 5: 87,254,112 Y220S probably benign Het
Unc79 C T 12: 103,094,976 T1145I probably damaging Het
Unc80 T A 1: 66,622,462 M1682K probably benign Het
Vcp A G 4: 42,982,891 S652P probably damaging Het
Wrnip1 T A 13: 32,816,327 L439* probably null Het
Zfhx2 A G 14: 55,066,750 I1259T possibly damaging Het
Zfp369 A T 13: 65,292,146 T215S probably benign Het
Zfp64 A T 2: 168,925,811 V627E probably damaging Het
Zfp873 T C 10: 82,059,939 I168T probably benign Het
Other mutations in Olfr148
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0113:Olfr148 UTSW 9 39614002 missense probably benign 0.11
R1514:Olfr148 UTSW 9 39613696 missense probably damaging 1.00
R1743:Olfr148 UTSW 9 39613620 missense possibly damaging 0.48
R2061:Olfr148 UTSW 9 39613775 missense probably benign
R2922:Olfr148 UTSW 9 39613764 missense probably benign 0.00
R4207:Olfr148 UTSW 9 39613957 missense possibly damaging 0.95
R4446:Olfr148 UTSW 9 39613998 missense probably benign
R4667:Olfr148 UTSW 9 39613738 missense probably damaging 1.00
R5407:Olfr148 UTSW 9 39613695 missense probably damaging 1.00
R5439:Olfr148 UTSW 9 39613620 missense probably benign 0.03
R5807:Olfr148 UTSW 9 39614463 missense probably benign 0.12
R6606:Olfr148 UTSW 9 39614082 missense probably damaging 1.00
R6729:Olfr148 UTSW 9 39613773 missense probably benign
R7216:Olfr148 UTSW 9 39614494 missense probably benign
R7697:Olfr148 UTSW 9 39613861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGTTGTTTCCACCAAGACC -3'
(R):5'- TATCGCAACATAACGATCATAGGC -3'

Sequencing Primer
(F):5'- AAGACCACCTCTGAAGATAATGG -3'
(R):5'- ATAGAGGCATCCTTCAGTAGAAC -3'
Posted On2019-10-07