Incidental Mutation 'R7470:Klf7'
ID579077
Institutional Source Beutler Lab
Gene Symbol Klf7
Ensembl Gene ENSMUSG00000025959
Gene NameKruppel-like factor 7 (ubiquitous)
Synonyms9830124P08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_033563; MGI: 1935151

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7470 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location64029447-64122282 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 64042313 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055001] [ENSMUST00000114086] [ENSMUST00000114086]
Predicted Effect silent
Transcript: ENSMUST00000055001
SMART Domains Protein: ENSMUSP00000054674
Gene: ENSMUSG00000025959

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
ZnF_C2H2 248 272 4.94e-5 SMART
ZnF_C2H2 278 300 6.78e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114086
SMART Domains Protein: ENSMUSP00000109720
Gene: ENSMUSG00000025959

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114086
SMART Domains Protein: ENSMUSP00000109720
Gene: ENSMUSG00000025959

DomainStartEndE-ValueType
low complexity region 134 145 N/A INTRINSIC
low complexity region 162 194 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
ZnF_C2H2 218 242 3.83e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Kruppel-like transcriptional regulator family. Members in this family regulate cell proliferation, differentiation and survival and contain three C2H2 zinc fingers at the C-terminus that mediate binding to GC-rich sites. This protein may contribute to the progression of type 2 diabetes by inhibiting insulin expression and secretion in pancreatic beta-cells and by deregulating adipocytokine secretion in adipocytes. A pseudogene of this gene is located on the long arm of chromosome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mice die within 3 days of life, showing lack of gastic milk, hypopnea, cyanosis, olfactory bulb hypoplasia, no response to tail clamping, impaired axon projection in the olfactory and visual systems, cerebral cortex and hippocampus, and reduced dendritic branching in the hippocampus. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A T 9: 55,991,338 V238E possibly damaging Het
Actn3 G A 19: 4,867,814 S375L possibly damaging Het
Adgrg6 T C 10: 14,444,066 T476A probably benign Het
Afm T A 5: 90,531,627 S327T probably damaging Het
Apol7e T A 15: 77,717,943 M247K probably benign Het
Aqp12 T A 1: 93,008,663 L237Q probably damaging Het
Arhgef12 A T 9: 43,040,552 S63T probably damaging Het
Axdnd1 T A 1: 156,376,516 E393V Het
Cacna1g T A 11: 94,461,939 D365V possibly damaging Het
Ccdc3 T A 2: 5,138,304 V124E possibly damaging Het
Ccr7 C T 11: 99,145,557 V180M possibly damaging Het
Cd47 T A 16: 49,884,222 I119K Het
Cenpe A T 3: 135,242,155 L1158F probably damaging Het
Cfi A G 3: 129,855,087 R207G probably benign Het
Cyp2j6 T C 4: 96,535,471 Y220C probably benign Het
Ddhd2 A G 8: 25,735,060 F577L probably benign Het
Dhx40 T C 11: 86,776,702 E537G probably damaging Het
Disp3 A T 4: 148,261,070 C438S possibly damaging Het
Dock3 A G 9: 107,005,445 S380P probably damaging Het
Ehmt2 A G 17: 34,899,396 E106G possibly damaging Het
Fmnl2 A T 2: 53,042,365 I119F probably damaging Het
Gm11554 A C 11: 99,804,364 S8A unknown Het
Gm9268 T A 7: 43,047,886 M789K probably damaging Het
Grm7 A G 6: 111,501,515 I54V Het
Hbs1l T C 10: 21,358,784 F579L possibly damaging Het
Hgf C A 5: 16,618,856 Q684K probably benign Het
Igsf3 T C 3: 101,451,075 Y741H possibly damaging Het
Il17rb C A 14: 29,998,033 G304W probably damaging Het
Ino80c C T 18: 24,108,838 W163* probably null Het
Kcnt1 A C 2: 25,909,833 D997A probably damaging Het
Lingo1 T C 9: 56,620,624 Y233C probably damaging Het
Lmo7 C A 14: 101,900,604 T914K possibly damaging Het
Mark1 G T 1: 184,928,044 Y138* probably null Het
Mcm3ap C A 10: 76,508,397 T1791K probably damaging Het
Mcts2 T C 2: 152,687,662 I131T probably benign Het
Mipep A G 14: 60,802,895 D288G probably benign Het
Ms4a8a T A 19: 11,076,350 N131Y possibly damaging Het
Nalcn T C 14: 123,572,044 E232G probably benign Het
Nat10 C T 2: 103,734,881 A452T probably benign Het
Nfatc2 G A 2: 168,523,307 Q596* probably null Het
Nudt13 G T 14: 20,309,723 G173W probably damaging Het
Olfr1 T A 11: 73,395,888 I45F probably damaging Het
Olfr1157 A T 2: 87,962,449 C148S possibly damaging Het
Olfr148 C A 9: 39,613,702 T45K probably benign Het
Olfr878 T A 9: 37,919,296 I213N probably damaging Het
Otud4 T C 8: 79,673,360 V901A probably benign Het
Pah G A 10: 87,563,424 R155Q probably damaging Het
Pkd1l3 A G 8: 109,638,376 H1130R probably benign Het
Pnliprp1 A G 19: 58,732,025 N111S possibly damaging Het
Ppp1r21 T C 17: 88,562,221 Y401H probably damaging Het
Prr14 A G 7: 127,475,825 K466R probably null Het
Ralgapa2 A G 2: 146,424,667 L663P probably damaging Het
Reg3d A T 6: 78,376,088 C171S possibly damaging Het
Reln G T 5: 21,942,741 L2404I probably damaging Het
Rnasel A C 1: 153,754,031 I98L probably benign Het
Rnf216 T C 5: 142,992,725 D886G possibly damaging Het
Rp1l1 A G 14: 64,028,566 R534G probably benign Het
Selenon A C 4: 134,539,750 S514A probably benign Het
Sema3d T A 5: 12,508,185 I228N probably damaging Het
Serpinb9g T A 13: 33,486,634 I35N probably damaging Het
Siglec1 A C 2: 131,075,824 H1044Q probably benign Het
Skint5 T A 4: 113,756,931 I693F unknown Het
Skint5 G T 4: 113,885,803 L370M unknown Het
Slc12a1 G A 2: 125,217,895 W905* probably null Het
Slc26a9 G C 1: 131,764,043 V675L probably benign Het
Slc5a7 A T 17: 54,276,962 Y433* probably null Het
Slc7a4 A G 16: 17,575,113 I274T probably benign Het
Slmap A G 14: 26,427,420 V612A probably benign Het
Spen T C 4: 141,479,294 D674G unknown Het
Ssh1 T C 5: 113,942,427 T981A possibly damaging Het
Sycp2l T C 13: 41,163,104 S180P probably benign Het
Tdrd7 C A 4: 45,990,144 S181R probably benign Het
Thada T C 17: 84,226,041 N1661D probably benign Het
Tsga13 C A 6: 30,900,046 D179Y possibly damaging Het
Ttf2 T G 3: 100,963,162 Q198H possibly damaging Het
Ugt2b37 T G 5: 87,254,112 Y220S probably benign Het
Unc79 C T 12: 103,094,976 T1145I probably damaging Het
Unc80 T A 1: 66,622,462 M1682K probably benign Het
Vcp A G 4: 42,982,891 S652P probably damaging Het
Wrnip1 T A 13: 32,816,327 L439* probably null Het
Zfhx2 A G 14: 55,066,750 I1259T possibly damaging Het
Zfp369 A T 13: 65,292,146 T215S probably benign Het
Zfp64 A T 2: 168,925,811 V627E probably damaging Het
Zfp873 T C 10: 82,059,939 I168T probably benign Het
Other mutations in Klf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Klf7 APN 1 64042317 missense possibly damaging 0.65
IGL01684:Klf7 APN 1 64120892 splice site probably benign
IGL01844:Klf7 APN 1 64078774 missense probably benign 0.02
IGL03181:Klf7 APN 1 64035726 missense possibly damaging 0.88
Esurientes UTSW 1 64079213 missense possibly damaging 0.78
C9142:Klf7 UTSW 1 64079157 missense possibly damaging 0.47
R1736:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R1737:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R1744:Klf7 UTSW 1 64079213 missense possibly damaging 0.78
R2048:Klf7 UTSW 1 64078754 missense possibly damaging 0.65
R2891:Klf7 UTSW 1 64042362 missense probably damaging 1.00
R5055:Klf7 UTSW 1 64079280 missense probably benign 0.08
R5613:Klf7 UTSW 1 64042396 missense probably damaging 0.98
R5782:Klf7 UTSW 1 64042411 missense possibly damaging 0.81
R7369:Klf7 UTSW 1 64121141 critical splice acceptor site probably null
R8501:Klf7 UTSW 1 64079163 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGCCAGCACTGAGTAAATGC -3'
(R):5'- GGGCATGAGATCCTTTCTGACC -3'

Sequencing Primer
(F):5'- TGCTATGTAACCCAATGGAGAC -3'
(R):5'- GCATGAGATCCTTTCTGACCATTGTC -3'
Posted On2019-10-07