Incidental Mutation 'R7520:Taar7b'
ID582636
Institutional Source Beutler Lab
Gene Symbol Taar7b
Ensembl Gene ENSMUSG00000095171
Gene Nametrace amine-associated receptor 7B
SynonymsLOC209517
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7520 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location23999939-24001015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24000483 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 182 (L182P)
Ref Sequence ENSEMBL: ENSMUSP00000090328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092658]
Predicted Effect probably damaging
Transcript: ENSMUST00000092658
AA Change: L182P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090328
Gene: ENSMUSG00000095171
AA Change: L182P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 56 261 1.9e-7 PFAM
Pfam:7tm_1 64 326 7.3e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 A T 4: 53,078,114 I886N probably benign Het
Adamts6 A G 13: 104,297,186 H41R probably benign Het
Adck1 T C 12: 88,459,205 probably null Het
Atat1 G T 17: 35,897,814 T398K probably benign Het
Bahcc1 A G 11: 120,276,205 E1144G possibly damaging Het
Cand2 G T 6: 115,785,251 E213* probably null Het
Cep350 A G 1: 155,915,629 S1250P probably benign Het
Cln3 A G 7: 126,581,680 L63P probably damaging Het
Col4a4 A T 1: 82,507,087 C486* probably null Het
Ctnnal1 A T 4: 56,837,838 M264K probably damaging Het
Ddr2 T A 1: 169,984,439 D738V probably damaging Het
Dnah6 T C 6: 73,127,904 M1901V probably benign Het
Dnhd1 A G 7: 105,696,048 T2200A probably benign Het
Dolk A G 2: 30,284,543 Y497H probably benign Het
Drd5 T C 5: 38,320,852 V396A probably benign Het
Epsti1 A T 14: 77,963,443 probably null Het
Erich3 A G 3: 154,763,126 T1072A unknown Het
Ero1l A T 14: 45,306,575 N57K probably damaging Het
Exph5 T C 9: 53,367,214 probably null Het
Frmd5 C T 2: 121,554,264 probably null Het
Gm13124 T C 4: 144,555,289 Y311C probably damaging Het
H2-Q7 A G 17: 35,442,710 T310A probably benign Het
Hecw2 G T 1: 53,926,056 A537E probably benign Het
Itga4 A T 2: 79,300,989 D567V probably damaging Het
Kcnu1 A T 8: 25,885,340 N361Y probably damaging Het
Keap1 A G 9: 21,233,491 S408P probably benign Het
Mamdc4 T A 2: 25,565,348 I928F possibly damaging Het
Mboat4 T C 8: 34,123,874 F155S probably benign Het
Mtbp A G 15: 55,577,346 probably benign Het
Nmi T G 2: 51,952,480 K200T probably benign Het
Olfr138 G A 17: 38,275,440 C223Y probably benign Het
Olfr27 G T 9: 39,144,118 R6L probably benign Het
Pcdha7 G A 18: 36,975,313 V464M probably damaging Het
Peg10 T A 6: 4,756,796 N457K unknown Het
Plekha7 A T 7: 116,137,284 I944N possibly damaging Het
Plpp1 T A 13: 112,801,247 D13E possibly damaging Het
Pnpla6 G T 8: 3,537,508 V1070F probably damaging Het
Riox1 T A 12: 83,951,771 Y360* probably null Het
Sdhb A G 4: 140,966,571 D50G possibly damaging Het
Slc35f2 T A 9: 53,801,101 V126D possibly damaging Het
Slmap A G 14: 26,427,420 V612A probably benign Het
Snap91 T A 9: 86,839,649 I46F probably damaging Het
Sp110 G A 1: 85,579,092 R417C Het
Tmc1 T A 19: 20,799,178 M606L probably damaging Het
Trpm8 T A 1: 88,343,321 D444E probably benign Het
Tsen54 A G 11: 115,820,971 T405A probably damaging Het
Ttll5 T C 12: 85,899,471 W492R probably damaging Het
Ttn T A 2: 76,897,779 T5566S unknown Het
Utp20 A T 10: 88,818,595 M210K probably damaging Het
Zfand1 A G 3: 10,345,949 V115A probably damaging Het
Other mutations in Taar7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Taar7b APN 10 24000842 missense probably benign 0.01
IGL00771:Taar7b APN 10 24000198 missense probably benign 0.01
IGL01662:Taar7b APN 10 23999976 missense probably benign 0.02
IGL02186:Taar7b APN 10 23999981 missense probably benign 0.00
IGL02399:Taar7b APN 10 24000152 missense probably damaging 0.99
IGL02514:Taar7b APN 10 24000984 missense probably benign 0.00
IGL02601:Taar7b APN 10 24000306 missense probably damaging 1.00
IGL02717:Taar7b APN 10 24000360 missense probably damaging 1.00
IGL02724:Taar7b APN 10 24000683 missense probably benign
IGL02725:Taar7b APN 10 24000063 missense probably benign 0.03
R0103:Taar7b UTSW 10 24000294 missense probably benign 0.00
R2060:Taar7b UTSW 10 24000675 missense possibly damaging 0.95
R4973:Taar7b UTSW 10 24000345 missense probably benign 0.08
R5055:Taar7b UTSW 10 24000947 missense possibly damaging 0.75
R5068:Taar7b UTSW 10 24000461 missense probably benign 0.00
R5069:Taar7b UTSW 10 24000461 missense probably benign 0.00
R5070:Taar7b UTSW 10 24000461 missense probably benign 0.00
R5205:Taar7b UTSW 10 24000018 missense probably benign 0.05
R5994:Taar7b UTSW 10 24000348 missense probably damaging 1.00
R6131:Taar7b UTSW 10 24000717 missense probably benign 0.20
R6302:Taar7b UTSW 10 24000260 missense possibly damaging 0.57
R6332:Taar7b UTSW 10 23999951 missense probably benign 0.05
R6809:Taar7b UTSW 10 24000858 missense probably benign 0.03
R7126:Taar7b UTSW 10 24000062 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTCAGCACAGTGAGGTCTG -3'
(R):5'- CTCAATGTTCTGAGCCTGCTG -3'

Sequencing Primer
(F):5'- GGGAGAGTTACTGTAAATTACACAC -3'
(R):5'- CTCAATGTTCTGAGCCTGCTGTTTAG -3'
Posted On2019-10-17