Incidental Mutation 'R7546:1700122O11Rik'
ID 584235
Institutional Source Beutler Lab
Gene Symbol 1700122O11Rik
Ensembl Gene ENSMUSG00000094928
Gene Name RIKEN cDNA 1700122O11 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7546 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 48036745-48038293 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48037521 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 36 (S36P)
Ref Sequence ENSEMBL: ENSMUSP00000137519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178823]
AlphaFold J3QPW6
Predicted Effect probably benign
Transcript: ENSMUST00000178823
AA Change: S36P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137519
Gene: ENSMUSG00000094928
AA Change: S36P

DomainStartEndE-ValueType
coiled coil region 42 73 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Ampd1 A G 3: 103,095,712 T582A probably benign Het
Ank1 A C 8: 23,064,995 N57T probably damaging Het
Atxn3 A G 12: 101,948,002 probably null Het
Bace2 G A 16: 97,399,682 A117T probably benign Het
Bcl2l15 A G 3: 103,832,887 N19S probably benign Het
Bid C A 6: 120,900,151 probably null Het
Cadps2 A T 6: 23,626,608 M227K probably benign Het
Clip4 G A 17: 71,828,702 C483Y possibly damaging Het
D5Ertd577e C T 5: 95,482,680 R139C probably benign Het
Dennd4a A G 9: 64,873,044 T621A probably damaging Het
E2f3 G A 13: 29,910,129 S383L probably damaging Het
F2r C T 13: 95,618,350 V9I probably benign Het
Gm10424 T A 5: 95,270,312 H275L possibly damaging Het
Gm14226 T C 2: 155,025,211 S363P probably damaging Het
Gm156 T C 6: 129,772,380 H84R probably benign Het
Gstm5 T C 3: 107,897,294 Y65H probably damaging Het
H60c A G 10: 3,259,907 W127R probably damaging Het
Hist1h2bl A G 13: 21,715,870 S92P probably benign Het
Itgav G T 2: 83,776,550 G448* probably null Het
Lhx6 C T 2: 36,103,345 probably null Het
Manba T A 3: 135,570,246 V816D probably benign Het
March10 G A 11: 105,390,080 P460S not run Het
Mmp17 T A 5: 129,596,589 V244E probably damaging Het
Mtrr C T 13: 68,582,149 probably benign Het
Nup160 T C 2: 90,685,058 I170T probably damaging Het
Olfr1255 A G 2: 89,817,019 N225S probably benign Het
Olfr1255 A T 2: 89,817,194 L283F probably damaging Het
Olfr558 T C 7: 102,709,789 S177P probably damaging Het
Pappa G A 4: 65,156,115 S302N possibly damaging Het
Plekhj1 G A 10: 80,797,914 A53V possibly damaging Het
Prpf8 T C 11: 75,508,374 V2157A probably damaging Het
Rps8 G A 4: 117,153,907 R200W probably damaging Het
Sesn2 A G 4: 132,499,843 F93L probably damaging Het
Slf1 A G 13: 77,049,192 S768P probably benign Het
Stat4 A G 1: 52,098,463 N471S probably damaging Het
Trcg1 T C 9: 57,248,338 L758P probably benign Het
Trim35 A G 14: 66,303,247 T183A probably benign Het
Ttc37 C A 13: 76,134,835 L759M probably damaging Het
Ttr C A 18: 20,670,045 Y89* probably null Het
Zfp90 C A 8: 106,424,691 H345Q probably benign Het
Zmym4 A G 4: 126,864,168 V1531A probably damaging Het
Other mutations in 1700122O11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02830:1700122O11Rik APN 17 48037426 missense possibly damaging 0.46
IGL02927:1700122O11Rik APN 17 48036920 nonsense probably null
R2013:1700122O11Rik UTSW 17 48036914 missense possibly damaging 0.53
R2014:1700122O11Rik UTSW 17 48036914 missense possibly damaging 0.53
R4698:1700122O11Rik UTSW 17 48038240 missense possibly damaging 0.46
R5194:1700122O11Rik UTSW 17 48037250 missense probably benign
R6352:1700122O11Rik UTSW 17 48037136 missense probably benign 0.08
R6512:1700122O11Rik UTSW 17 48036863 missense possibly damaging 0.83
R8429:1700122O11Rik UTSW 17 48037066 nonsense probably null
R9089:1700122O11Rik UTSW 17 48037142 nonsense probably null
R9165:1700122O11Rik UTSW 17 48037548 missense probably benign 0.05
R9377:1700122O11Rik UTSW 17 48037464 missense probably benign
R9442:1700122O11Rik UTSW 17 48036771 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GGCCTTGATCCTGAGCAAAAG -3'
(R):5'- AGGCCTAAATCTGGGGTGAG -3'

Sequencing Primer
(F):5'- CCGATATGGTCATAGAGTGAGGCTC -3'
(R):5'- CCTAAATCTGGGGTGAGAGTGTGAG -3'
Posted On 2019-10-17