Incidental Mutation 'R7566:Olfr1360'
List |< first << previous [record 34 of 55] next >> last >|
ID585466
Institutional Source Beutler Lab
Gene Symbol Olfr1360
Ensembl Gene ENSMUSG00000108534
Gene Nameolfactory receptor 1360
SynonymsMOR256-10, GA_x6K02T2QHY8-11561962-11562903, MOR256-35
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21673431-21677405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 21674567 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 126 (I126L)
Ref Sequence ENSEMBL: ENSMUSP00000146159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079135] [ENSMUST00000205788] [ENSMUST00000216083]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079135
AA Change: I126L

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074361
Gene: ENSMUSG00000108534
AA Change: I126L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3e-55 PFAM
Pfam:7tm_1 41 290 1.1e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205788
AA Change: I126L

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216083
AA Change: I126L

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prkce A T 17: 86,493,329 E391V probably benign Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Olfr1360
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Olfr1360 APN 13 21674617 missense probably benign 0.12
IGL02886:Olfr1360 APN 13 21674952 utr 5 prime probably benign
IGL03157:Olfr1360 APN 13 21674942 start codon destroyed probably null 0.48
R1540:Olfr1360 UTSW 13 21674530 missense probably benign 0.11
R1756:Olfr1360 UTSW 13 21674695 missense probably benign 0.00
R1843:Olfr1360 UTSW 13 21674672 missense probably benign 0.00
R3793:Olfr1360 UTSW 13 21674983 unclassified probably null
R5707:Olfr1360 UTSW 13 21674599 missense probably damaging 1.00
Z1177:Olfr1360 UTSW 13 21675154 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACTGATGAAGAACAGCTCTGC -3'
(R):5'- GACCTGTGCTACACCACAAG -3'

Sequencing Primer
(F):5'- ATTAGCTGTCGTATCCACACAGG -3'
(R):5'- AGCACGGTCCCACAGATG -3'
Posted On2019-10-17