Incidental Mutation 'R7566:Prkce'
ID585472
Institutional Source Beutler Lab
Gene Symbol Prkce
Ensembl Gene ENSMUSG00000045038
Gene Nameprotein kinase C, epsilon
SynonymsPkce, PKCepsilon, PKC[e], 5830406C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7566 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location86167785-86657919 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86493329 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 391 (E391V)
Ref Sequence ENSEMBL: ENSMUSP00000094873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095186] [ENSMUST00000097274] [ENSMUST00000097275]
Predicted Effect probably benign
Transcript: ENSMUST00000095186
Predicted Effect probably benign
Transcript: ENSMUST00000097274
AA Change: E391V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094873
Gene: ENSMUSG00000045038
AA Change: E391V

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097275
AA Change: E391V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000094874
Gene: ENSMUSG00000045038
AA Change: E391V

DomainStartEndE-ValueType
C2 7 114 5.78e-12 SMART
C1 170 220 4.48e-13 SMART
C1 243 292 8.29e-17 SMART
S_TKc 408 668 1.3e-104 SMART
S_TK_X 669 732 2.56e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced ethanol self-administration and are more sensitive to the acute behavioral effects of ethanol and other drugs that activate GABA(A) receptors. Mutants show reduced anxiety and stress hormones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T G 1: 11,951,028 S420R probably damaging Het
Acat2 C T 17: 12,947,459 D219N probably damaging Het
Anapc10 G A 8: 79,719,679 R46Q possibly damaging Het
Ankub1 G A 3: 57,665,618 R228* probably null Het
Arhgap21 T C 2: 20,912,291 N91S probably benign Het
Arhgap32 T A 9: 32,250,722 V323D probably benign Het
Bcas1 C T 2: 170,370,449 probably null Het
C530008M17Rik G A 5: 76,866,275 probably null Het
Cd109 C T 9: 78,680,837 P716S probably damaging Het
Chd4 C T 6: 125,101,903 P267L possibly damaging Het
Cpne7 G T 8: 123,133,813 V502F probably damaging Het
Dlgap4 C T 2: 156,762,737 A921V probably benign Het
Faap24 G T 7: 35,393,040 R151S probably benign Het
Fam98a A G 17: 75,547,662 S51P probably damaging Het
Fbxl8 A G 8: 105,268,306 D150G possibly damaging Het
Fut10 A G 8: 31,259,922 K412R probably benign Het
G0s2 T C 1: 193,272,768 S3G probably benign Het
Gm1527 T C 3: 28,920,618 Y527H probably benign Het
Gsdmc3 T C 15: 63,861,661 K227R possibly damaging Het
Gtf2ird2 A G 5: 134,214,006 Y354C probably damaging Het
Hmcn2 T A 2: 31,454,857 N4685K probably damaging Het
Itgad A T 7: 128,192,107 Y717F probably benign Het
Kcnh5 C T 12: 75,114,392 W247* probably null Het
Kcnt1 C A 2: 25,916,036 S1212R probably benign Het
Kirrel A G 3: 87,088,484 V381A probably damaging Het
Loxl1 T A 9: 58,312,198 Q230L probably damaging Het
Magi1 T C 6: 93,678,327 E1446G probably benign Het
Man1a A G 10: 53,919,234 V550A possibly damaging Het
Mgat4d T C 8: 83,358,023 S132P probably damaging Het
Muc16 T A 9: 18,638,629 H5456L probably benign Het
Nhsl1 A G 10: 18,516,119 K207R probably damaging Het
Nlrp4a A C 7: 26,449,245 probably null Het
Nr6a1 T C 2: 38,731,073 M407V possibly damaging Het
Olfr1360 T G 13: 21,674,567 I126L possibly damaging Het
Olfr156 A G 4: 43,820,711 S217P probably damaging Het
Olfr30 G T 11: 58,455,663 F95L probably benign Het
Olfr776 T C 10: 129,261,600 I213T probably damaging Het
Ovgp1 A G 3: 105,974,310 probably benign Het
Ovol3 G T 7: 30,234,366 F110L probably damaging Het
Pcsk5 T C 19: 17,572,457 T724A probably benign Het
Phtf2 G T 5: 20,765,801 T653N probably damaging Het
Plch1 A T 3: 63,781,242 probably null Het
Prob1 A G 18: 35,654,985 V72A probably benign Het
Prrc2b C A 2: 32,194,390 P289Q probably benign Het
Ptbp3 A T 4: 59,514,280 N114K probably benign Het
Rho T A 6: 115,932,174 L57H probably damaging Het
Slc44a5 A C 3: 154,269,989 D679A probably damaging Het
Slit2 A T 5: 48,249,897 D898V probably damaging Het
Spag16 C T 1: 69,870,328 R195C probably damaging Het
Tmprss11a T G 5: 86,444,134 D60A possibly damaging Het
Ttn T A 2: 76,734,949 R28311S probably damaging Het
Wfikkn1 T C 17: 25,878,378 D324G probably damaging Het
Zan A C 5: 137,412,583 probably null Het
Zfp945 A T 17: 22,851,753 C412S possibly damaging Het
Other mutations in Prkce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Prkce APN 17 86625462 missense probably damaging 0.99
IGL01401:Prkce APN 17 86168840 missense probably damaging 1.00
IGL01508:Prkce APN 17 86630085 missense probably damaging 1.00
IGL02500:Prkce APN 17 86168914 missense probably benign 0.16
IGL02957:Prkce APN 17 86496026 missense possibly damaging 0.74
IGL03114:Prkce APN 17 86654555 missense probably damaging 0.97
Pinnacles UTSW 17 86476851 missense probably damaging 1.00
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0063:Prkce UTSW 17 86482111 splice site probably benign
R0403:Prkce UTSW 17 86168653 missense probably damaging 0.98
R0900:Prkce UTSW 17 86625458 missense probably damaging 1.00
R0919:Prkce UTSW 17 86630160 missense probably benign 0.06
R1413:Prkce UTSW 17 86496018 missense possibly damaging 0.81
R1430:Prkce UTSW 17 86559137 splice site probably benign
R1843:Prkce UTSW 17 86475546 nonsense probably null
R2129:Prkce UTSW 17 86496035 missense possibly damaging 0.89
R2341:Prkce UTSW 17 86474442 missense probably damaging 1.00
R2511:Prkce UTSW 17 86625326 missense probably damaging 1.00
R2679:Prkce UTSW 17 86176226 intron probably benign
R3724:Prkce UTSW 17 86168623 nonsense probably null
R3853:Prkce UTSW 17 86168849 missense probably damaging 1.00
R4364:Prkce UTSW 17 86476851 missense probably damaging 1.00
R4467:Prkce UTSW 17 86619911 missense possibly damaging 0.68
R4523:Prkce UTSW 17 86490750 critical splice acceptor site probably null
R4838:Prkce UTSW 17 86630083 missense probably benign 0.07
R5140:Prkce UTSW 17 86482142 missense probably benign 0.12
R5579:Prkce UTSW 17 86619948 missense probably damaging 1.00
R6026:Prkce UTSW 17 86493230 missense probably benign 0.02
R6048:Prkce UTSW 17 86493347 missense probably benign
R6212:Prkce UTSW 17 86559301 missense probably damaging 1.00
R6484:Prkce UTSW 17 86490809 missense probably benign
R6788:Prkce UTSW 17 86630061 missense probably damaging 1.00
R6915:Prkce UTSW 17 86493407 missense probably damaging 1.00
R7349:Prkce UTSW 17 86493355 missense probably benign
R7447:Prkce UTSW 17 86559259 missense probably damaging 1.00
R7577:Prkce UTSW 17 86493293 nonsense probably null
R7638:Prkce UTSW 17 86168600 missense probably benign 0.26
R8237:Prkce UTSW 17 86559218 missense probably damaging 1.00
RF010:Prkce UTSW 17 86488199 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CATGGGTCCTGAAGGTTGAG -3'
(R):5'- ACACATGAAACTGCTCAGTGTG -3'

Sequencing Primer
(F):5'- GTCTTAATGTAAATGGCTCATGAGG -3'
(R):5'- ATGAAACTGCTCAGTGTGGTCCC -3'
Posted On2019-10-17