Incidental Mutation 'R7630:Tapbp'
ID589613
Institutional Source Beutler Lab
Gene Symbol Tapbp
Ensembl Gene ENSMUSG00000024308
Gene NameTAP binding protein
SynonymsTPN, tapasin, D17Wsu91e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R7630 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33915899-33929288 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33920344 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 105 (S105P)
Ref Sequence ENSEMBL: ENSMUSP00000025161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000053429] [ENSMUST00000079421] [ENSMUST00000170075] [ENSMUST00000172619] [ENSMUST00000174146] [ENSMUST00000174463] [ENSMUST00000174541]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
AA Change: S105P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308
AA Change: S105P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053429
SMART Domains Protein: ENSMUSP00000057466
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
BTB 57 151 7.21e-22 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 317 355 N/A INTRINSIC
low complexity region 390 403 N/A INTRINSIC
low complexity region 431 443 N/A INTRINSIC
low complexity region 460 479 N/A INTRINSIC
ZnF_C2H2 483 504 1.24e2 SMART
ZnF_C2H2 510 532 1.28e-3 SMART
ZnF_C2H2 538 559 4.69e0 SMART
low complexity region 567 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079421
SMART Domains Protein: ENSMUSP00000078390
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:Daxx 54 152 1.3e-51 PFAM
Blast:KISc 185 261 2e-17 BLAST
PDB:4H9S|F 189 404 1e-131 PDB
SCOP:d1sig__ 437 493 7e-3 SMART
low complexity region 573 584 N/A INTRINSIC
low complexity region 693 715 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170075
SMART Domains Protein: ENSMUSP00000128504
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172619
AA Change: S96P

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134695
Gene: ENSMUSG00000024308
AA Change: S96P

DomainStartEndE-ValueType
PDB:3F8U|D 12 119 1e-38 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174146
SMART Domains Protein: ENSMUSP00000134158
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 740 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174463
SMART Domains Protein: ENSMUSP00000133345
Gene: ENSMUSG00000051390

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Pfam:BTB 47 87 7.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174541
SMART Domains Protein: ENSMUSP00000133552
Gene: ENSMUSG00000002307

DomainStartEndE-ValueType
Pfam:Daxx 1 702 1.5e-297 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane glycoprotein which mediates interaction between newly assembled major histocompatibility complex (MHC) class I molecules and the transporter associated with antigen processing (TAP), which is required for the transport of antigenic peptides across the endoplasmic reticulum membrane. This interaction is essential for optimal peptide loading on the MHC class I molecule. Up to four complexes of MHC class I and this protein may be bound to a single TAP molecule. This protein contains a C-terminal double-lysine motif (KKKAE) known to maintain membrane proteins in the endoplasmic reticulum. This gene lies within the major histocompatibility complex on chromosome 6. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced and thermolabile MHC class I surface expression due to impaired peptide loading with stabilizing peptides, impaired T cell selection, altered NK repertoire, lower CD8+ T cell numbers, and impaired responses to select class I-restricted antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530084C06Rik G T 13: 31,558,995 R92S unknown Het
Agbl1 A T 7: 76,886,156 I1019F unknown Het
Arhgap15 A G 2: 43,780,636 T11A probably benign Het
Armh1 C A 4: 117,213,741 A396S probably benign Het
Atg2b T C 12: 105,646,954 probably null Het
Aup1 C A 6: 83,054,923 D50E unknown Het
Ccl25 A G 8: 4,353,955 Y49C probably damaging Het
Cnga3 A G 1: 37,258,046 D148G probably damaging Het
Cpeb3 A T 19: 37,054,293 F570I probably damaging Het
Cyp3a16 T A 5: 145,436,310 probably null Het
Eif2d C T 1: 131,154,366 T65M probably benign Het
Fryl T C 5: 73,110,245 I426V possibly damaging Het
Hgf T C 5: 16,598,250 S387P probably benign Het
Hyal6 T C 6: 24,734,584 V172A probably damaging Het
Il10ra T C 9: 45,256,071 D396G probably damaging Het
Kif26a A G 12: 112,175,697 D795G probably damaging Het
Lrrc8c T A 5: 105,607,702 S448T probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Notch2 A G 3: 98,137,508 D1582G possibly damaging Het
Olfr296-ps1 T C 7: 86,562,472 S247P probably damaging Het
Olfr364-ps1 A C 2: 37,146,359 D49A probably damaging Het
Osmr T C 15: 6,816,971 I741V possibly damaging Het
Park2 A G 17: 11,237,568 E93G probably benign Het
Plec C T 15: 76,190,616 probably null Het
Prkag3 A G 1: 74,744,735 F330L probably damaging Het
Rexo4 A T 2: 26,960,610 F247I probably damaging Het
Rph3a T C 5: 120,943,050 D628G probably damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Scnn1g T C 7: 121,760,481 S396P probably damaging Het
Slc1a5 G A 7: 16,795,807 V384M probably damaging Het
Sltm C G 9: 70,586,673 P802R possibly damaging Het
Smc4 CTA CTATA 3: 69,018,067 probably benign Het
Synpo2 A G 3: 123,080,032 V1154A probably damaging Het
Tanc2 T C 11: 105,776,908 V105A probably benign Het
Tmem5 T C 10: 122,095,960 I103V possibly damaging Het
Tmem79 T C 3: 88,333,461 E60G possibly damaging Het
Txnrd2 A G 16: 18,438,390 D152G possibly damaging Het
Vcl T A 14: 20,983,402 L142* probably null Het
Vmn2r58 T C 7: 41,864,187 Y344C probably damaging Het
Vmn2r-ps117 A G 17: 18,824,647 D442G probably benign Het
Xpo6 A T 7: 126,140,389 probably null Het
Other mutations in Tapbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tapbp APN 17 33919892 missense probably benign
IGL00229:Tapbp APN 17 33925704 missense probably damaging 1.00
R0002:Tapbp UTSW 17 33925632 missense probably damaging 0.98
R0416:Tapbp UTSW 17 33925418 missense probably damaging 0.99
R0800:Tapbp UTSW 17 33926253 missense probably benign 0.39
R0839:Tapbp UTSW 17 33925743 missense probably benign 0.00
R1584:Tapbp UTSW 17 33919940 splice site probably null
R1617:Tapbp UTSW 17 33920431 missense probably benign 0.06
R2214:Tapbp UTSW 17 33920326 missense possibly damaging 0.90
R3941:Tapbp UTSW 17 33920483 missense possibly damaging 0.91
R4570:Tapbp UTSW 17 33926453 missense probably damaging 1.00
R4571:Tapbp UTSW 17 33926453 missense probably damaging 1.00
R4935:Tapbp UTSW 17 33925622 missense probably benign 0.02
R6195:Tapbp UTSW 17 33919982 missense probably damaging 1.00
R6233:Tapbp UTSW 17 33919982 missense probably damaging 1.00
R6468:Tapbp UTSW 17 33926098 missense probably damaging 1.00
R6736:Tapbp UTSW 17 33919957 missense possibly damaging 0.85
R7139:Tapbp UTSW 17 33920048 missense possibly damaging 0.46
R7146:Tapbp UTSW 17 33925487 missense possibly damaging 0.93
R7233:Tapbp UTSW 17 33919969 missense probably damaging 0.99
R7448:Tapbp UTSW 17 33920417 missense possibly damaging 0.70
R8545:Tapbp UTSW 17 33920317 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GGGACTTACCTGCATCTGTC -3'
(R):5'- CCTGTTGCCATGGTGATGAC -3'

Sequencing Primer
(F):5'- AATACGTTTGGATGCTCTCTAAGTCG -3'
(R):5'- TTGCCATGGTGATGACGACAG -3'
Posted On2019-10-24