Incidental Mutation 'R7696:Afap1l2'
ID593685
Institutional Source Beutler Lab
Gene Symbol Afap1l2
Ensembl Gene ENSMUSG00000025083
Gene Nameactin filament associated protein 1-like 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7696 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location56912361-57008228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 56914486 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 754 (V754L)
Ref Sequence ENSEMBL: ENSMUSP00000107210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026068] [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359]
Predicted Effect probably benign
Transcript: ENSMUST00000026068
SMART Domains Protein: ENSMUSP00000026068
Gene: ENSMUSG00000025082

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 49 222 6.9e-35 SMART
EGF 297 332 2.99e-4 SMART
VWA 340 517 1.26e-28 SMART
VWA 528 705 1.55e-37 SMART
EGF 714 747 5e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111584
AA Change: V754L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083
AA Change: V754L

DomainStartEndE-ValueType
Blast:PH 30 153 3e-60 BLAST
low complexity region 160 170 N/A INTRINSIC
PH 194 291 9.27e-9 SMART
PH 372 467 3.11e-10 SMART
low complexity region 531 543 N/A INTRINSIC
low complexity region 611 626 N/A INTRINSIC
coiled coil region 675 772 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118800
AA Change: V736L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083
AA Change: V736L

DomainStartEndE-ValueType
Blast:PH 12 135 3e-60 BLAST
low complexity region 142 152 N/A INTRINSIC
PH 176 273 9.27e-9 SMART
PH 354 449 3.11e-10 SMART
low complexity region 513 525 N/A INTRINSIC
low complexity region 593 608 N/A INTRINSIC
coiled coil region 657 754 N/A INTRINSIC
low complexity region 773 786 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122359
AA Change: V680L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083
AA Change: V680L

DomainStartEndE-ValueType
Blast:PH 1 79 3e-32 BLAST
low complexity region 86 96 N/A INTRINSIC
PH 120 217 9.27e-9 SMART
PH 298 393 3.11e-10 SMART
low complexity region 457 469 N/A INTRINSIC
low complexity region 537 552 N/A INTRINSIC
coiled coil region 601 698 N/A INTRINSIC
low complexity region 717 730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610044O15Rik8 A G 8: 129,219,313 Y344H probably benign Het
Adamts12 C T 15: 11,258,138 R512C probably damaging Het
Atp5a1 T A 18: 77,780,986 I393N probably damaging Het
Bbs1 C T 19: 4,890,989 probably null Het
Bglap2 A T 3: 88,378,616 L12Q unknown Het
Bsn C T 9: 108,114,501 V1351I probably damaging Het
Cbx1 T C 11: 96,806,642 V147A probably damaging Het
Cep192 T A 18: 67,820,363 S484T probably damaging Het
Col18a1 A T 10: 77,085,272 I298K unknown Het
Cyp27a1 A T 1: 74,732,039 I128L probably benign Het
Dhdds C T 4: 133,996,914 A30T probably damaging Het
Dnajc12 A G 10: 63,407,132 N143S probably benign Het
Eno3 T G 11: 70,661,983 N363K probably benign Het
Galnt10 T A 11: 57,769,538 D267E probably damaging Het
Galr2 C T 11: 116,283,167 R208C probably damaging Het
Hif3a G A 7: 17,054,787 R82C unknown Het
Hspg2 T A 4: 137,511,966 F401L possibly damaging Het
Iars G T 13: 49,706,738 W455L probably damaging Het
Irf1 C T 11: 53,776,336 H294Y probably benign Het
Itgal T C 7: 127,330,184 L1091P probably damaging Het
Lrrc37a T G 11: 103,498,437 D2054A probably benign Het
Map3k2 T A 18: 32,220,594 H472Q probably benign Het
Myo18b T C 5: 112,692,292 D2545G probably damaging Het
Nle1 G T 11: 82,904,966 Y218* probably null Het
Pdlim5 A T 3: 142,277,862 S377T probably benign Het
Plch1 A T 3: 63,755,305 M259K probably benign Het
Pou6f1 A G 15: 100,584,098 V268A probably benign Het
Prn C A 2: 131,946,445 L7I unknown Het
Prpf6 C T 2: 181,608,242 A65V possibly damaging Het
Rarres1 A T 3: 67,491,012 F138L probably benign Het
Ros1 C T 10: 52,142,283 V781M probably damaging Het
Sec16a C A 2: 26,415,633 probably null Het
Slc44a4 G A 17: 34,928,700 G606D probably damaging Het
Slco1a4 A T 6: 141,810,511 C538* probably null Het
Slco1c1 A G 6: 141,567,610 Y537C probably benign Het
Speg T A 1: 75,429,161 L3003Q probably damaging Het
Ssr3 A G 3: 65,392,465 S25P probably benign Het
Stard13 C A 5: 151,060,802 R623L probably damaging Het
Tbc1d5 A G 17: 50,874,577 I376T probably damaging Het
Tigd4 C A 3: 84,594,917 F380L possibly damaging Het
Tmc4 T C 7: 3,669,575 K489E probably damaging Het
Tmem114 C T 16: 8,424,489 R55H probably benign Het
Tmem168 A G 6: 13,602,938 I143T probably benign Het
Tmem87b C T 2: 128,841,317 T397I probably damaging Het
Tom1l1 C A 11: 90,672,915 R173L probably benign Het
Trim10 G A 17: 36,871,752 R170K probably damaging Het
Usp6nl T A 2: 6,424,323 Y222N probably damaging Het
Vmn2r26 A T 6: 124,061,535 I690F possibly damaging Het
Other mutations in Afap1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Afap1l2 APN 19 57002308 splice site probably benign
IGL01012:Afap1l2 APN 19 56930261 missense probably damaging 0.98
IGL01089:Afap1l2 APN 19 56913411 splice site probably null
IGL01150:Afap1l2 APN 19 56930186 missense probably damaging 0.99
IGL02393:Afap1l2 APN 19 56914440 missense probably damaging 1.00
IGL02887:Afap1l2 APN 19 56920563 missense probably damaging 1.00
IGL03060:Afap1l2 APN 19 56914250 nonsense probably null
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0102:Afap1l2 UTSW 19 56928440 unclassified probably benign
R0282:Afap1l2 UTSW 19 56916221 missense possibly damaging 0.65
R0388:Afap1l2 UTSW 19 56917242 splice site probably benign
R0432:Afap1l2 UTSW 19 56917119 splice site probably benign
R0497:Afap1l2 UTSW 19 56930209 missense probably benign 0.27
R0578:Afap1l2 UTSW 19 56915782 missense probably benign 0.04
R0631:Afap1l2 UTSW 19 56916085 missense probably benign 0.39
R0670:Afap1l2 UTSW 19 56915803 missense probably damaging 1.00
R1188:Afap1l2 UTSW 19 56925069 missense probably damaging 0.97
R1236:Afap1l2 UTSW 19 56916472 missense possibly damaging 0.64
R1274:Afap1l2 UTSW 19 56914563 missense probably benign 0.02
R1463:Afap1l2 UTSW 19 56930151 missense probably benign 0.01
R1497:Afap1l2 UTSW 19 56928311 missense probably benign 0.25
R1597:Afap1l2 UTSW 19 56914449 missense probably benign 0.14
R1778:Afap1l2 UTSW 19 56916206 missense possibly damaging 0.68
R1795:Afap1l2 UTSW 19 56928409 missense probably damaging 1.00
R1991:Afap1l2 UTSW 19 57002267 missense possibly damaging 0.62
R2113:Afap1l2 UTSW 19 56913389 missense possibly damaging 0.95
R2242:Afap1l2 UTSW 19 56914468 missense possibly damaging 0.56
R3429:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3430:Afap1l2 UTSW 19 56915806 missense probably damaging 1.00
R3698:Afap1l2 UTSW 19 56916523 missense possibly damaging 0.69
R4706:Afap1l2 UTSW 19 56937240 missense possibly damaging 0.76
R4956:Afap1l2 UTSW 19 56943447 missense probably benign 0.00
R4993:Afap1l2 UTSW 19 56918040 missense probably damaging 1.00
R5772:Afap1l2 UTSW 19 56922974 missense probably benign 0.02
R5878:Afap1l2 UTSW 19 56915675 missense probably benign 0.01
R6194:Afap1l2 UTSW 19 56922951 missense probably damaging 1.00
R6226:Afap1l2 UTSW 19 56916128 missense probably benign 0.00
R6334:Afap1l2 UTSW 19 56917976 unclassified probably null
R6439:Afap1l2 UTSW 19 56928386 missense possibly damaging 0.91
R7332:Afap1l2 UTSW 19 56918121 missense probably damaging 1.00
R7524:Afap1l2 UTSW 19 56918111 missense probably damaging 1.00
R7577:Afap1l2 UTSW 19 56944767 missense probably damaging 1.00
R7741:Afap1l2 UTSW 19 56914482 missense probably damaging 1.00
X0062:Afap1l2 UTSW 19 56918033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGACTGGGTCAAATTACTATG -3'
(R):5'- CCATTTAATGTGCACAGGGC -3'

Sequencing Primer
(F):5'- CTCTACCACCCTGTGCCAG -3'
(R):5'- ATAGGAGCCCATGGACGTCATTC -3'
Posted On2019-11-12