Mutagenetix > Incidental Mutation

Incidental Mutation 'R5772:Afap1l2'

445479

Institutional Source

Beutler Lab

Gene Symbol

Afap1l2

Ensembl Gene

ENSMUSG00000025083

Gene Name

actin filament associated protein 1-like 2

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.092) question?

Stock #

R5772 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56912361-57008228 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 56922974 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 289 (T289A)

Ref Sequence

ENSEMBL: ENSMUSP00000112387 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111584] [ENSMUST00000118800] [ENSMUST00000122359] [ENSMUST00000148049]

AlphaFold

Q5DTU0

Predicted Effect

probably benign
Transcript: ENSMUST00000111584
AA Change: T363A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000107210
Gene: ENSMUSG00000025083
AA Change: T363A

Domain	Start	End	E-Value	Type
Blast:PH	30	153	3e-60	BLAST
low complexity region	160	170	N/A	INTRINSIC
PH	194	291	9.27e-9	SMART
PH	372	467	3.11e-10	SMART
low complexity region	531	543	N/A	INTRINSIC
low complexity region	611	626	N/A	INTRINSIC
coiled coil region	675	772	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118800
AA Change: T345A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000113745
Gene: ENSMUSG00000025083
AA Change: T345A

Domain	Start	End	E-Value	Type
Blast:PH	12	135	3e-60	BLAST
low complexity region	142	152	N/A	INTRINSIC
PH	176	273	9.27e-9	SMART
PH	354	449	3.11e-10	SMART
low complexity region	513	525	N/A	INTRINSIC
low complexity region	593	608	N/A	INTRINSIC
coiled coil region	657	754	N/A	INTRINSIC
low complexity region	773	786	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122359
AA Change: T289A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000112387
Gene: ENSMUSG00000025083
AA Change: T289A

Domain	Start	End	E-Value	Type
Blast:PH	1	79	3e-32	BLAST
low complexity region	86	96	N/A	INTRINSIC
PH	120	217	9.27e-9	SMART
PH	298	393	3.11e-10	SMART
low complexity region	457	469	N/A	INTRINSIC
low complexity region	537	552	N/A	INTRINSIC
coiled coil region	601	698	N/A	INTRINSIC
low complexity region	717	730	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148049

SMART Domains

Protein: ENSMUSP00000120490
Gene: ENSMUSG00000025083

Domain	Start	End	E-Value	Type
Blast:PH	1	79	2e-34	BLAST
low complexity region	86	96	N/A	INTRINSIC
PH	120	217	9.27e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155467

Meta Mutation Damage Score

0.0615

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (64/65)

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	T	7: 34,253,988	W238R	probably damaging	Het
4932416K20Rik	G	A	8: 104,797,639		noncoding transcript	Het
Abcg8	A	T	17: 84,686,699	E48V	probably damaging	Het
Atf6	T	A	1: 170,747,189	D560V	probably damaging	Het
Bcl2l14	A	T	6: 134,427,399	K183N	probably damaging	Het
Carmil3	T	C	14: 55,493,239	L52P	probably damaging	Het
Cct3	T	A	3: 88,300,967	N61K	probably damaging	Het
Col18a1	A	G	10: 77,166,343	V10A	unknown	Het
Col26a1	G	A	5: 136,847,566	Q67*	probably null	Het
Cyp2d34	T	C	15: 82,617,140	D329G	probably null	Het
Dchs1	T	A	7: 105,773,040	I58F	probably damaging	Het
Ddx60	T	C	8: 61,948,897	L269P	probably damaging	Het
Dis3l2	G	A	1: 86,878,432	G325D	probably damaging	Het
Dync1h1	A	T	12: 110,646,273	K2861*	probably null	Het
Ednra	A	G	8: 77,675,067	I198T	possibly damaging	Het
Ep300	T	C	15: 81,639,914		probably benign	Het
Fam120a	G	A	13: 48,880,933	P1068S	probably benign	Het
Fsip2	A	T	2: 82,984,740	M3606L	probably benign	Het
Gm7713	T	C	15: 59,994,643		noncoding transcript	Het
Gm9833	A	G	3: 10,088,506	R112G	probably damaging	Het
Gprin3	A	T	6: 59,354,413	V303D	possibly damaging	Het
Hmcn1	A	T	1: 150,694,878	V2178D	possibly damaging	Het
Hoxa11	A	G	6: 52,245,400	V107A	possibly damaging	Het
Iqub	C	A	6: 24,454,251	M544I	possibly damaging	Het
Itgb4	A	T	11: 115,988,432		probably benign	Het
Itpkb	A	G	1: 180,334,253		probably benign	Het
Kalrn	A	T	16: 33,975,820	V1195E	probably damaging	Het
Kif12	C	A	4: 63,165,941	R608M	probably damaging	Het
Lcorl	A	T	5: 45,795,367		probably null	Het
Lrrc24	T	C	15: 76,722,710	E162G	probably damaging	Het
Med6	A	G	12: 81,579,644	S119P	probably damaging	Het
Mmab	A	C	5: 114,436,714	L166R	probably damaging	Het
Nom1	A	G	5: 29,446,875	K737R	possibly damaging	Het
Obscn	T	C	11: 59,056,144	S4352G	probably damaging	Het
Olfr1130	A	T	2: 87,608,173	T262S	probably benign	Het
Olfr1277	A	T	2: 111,269,712	Y218*	probably null	Het
Olfr212	A	C	6: 116,515,951	D58A	possibly damaging	Het
Olfr225	T	A	11: 59,613,886	D307E	probably benign	Het
Pdzrn3	G	A	6: 101,172,314	S351L	probably benign	Het
Pdzrn4	A	T	15: 92,757,681	E485V	probably damaging	Het
Prkdc	T	A	16: 15,779,388	I2804K	possibly damaging	Het
Psg28	A	G	7: 18,430,715	L24P	probably damaging	Het
Resp18	A	G	1: 75,274,000	V145A	possibly damaging	Het
Rgl3	T	C	9: 21,981,612	M259V	probably benign	Het
Rhot2	A	T	17: 25,839,807	S540T	probably benign	Het
Ring1	T	C	17: 34,022,308	Y278C	possibly damaging	Het
Rpn2	A	G	2: 157,295,345	Y216C	probably damaging	Het
Scgb2b18	G	A	7: 33,173,830	L5F	unknown	Het
Slamf7	T	C	1: 171,639,270		probably null	Het
Slc22a12	T	C	19: 6,540,449	N237S	possibly damaging	Het
Spen	A	T	4: 141,478,184	V1044D	unknown	Het
Sqor	A	T	2: 122,809,341	M175L	probably benign	Het
Stx16	G	A	2: 174,093,499	G156R	probably damaging	Het
Tarsl2	T	G	7: 65,684,125	F632V	probably damaging	Het
Tln1	A	G	4: 43,545,191	V1008A	probably benign	Het
Tmem145	A	G	7: 25,315,614	H554R	probably benign	Het
Trank1	A	T	9: 111,366,676	D1256V	possibly damaging	Het
Trbv19	A	G	6: 41,178,860	Y55C	possibly damaging	Het
Ttc23l	C	T	15: 10,551,469	C57Y	probably benign	Het
Uap1	A	T	1: 170,161,380	C158S	probably benign	Het
Zfp353-ps	T	A	8: 42,082,610		noncoding transcript	Het
Zfp629	T	A	7: 127,611,135	I501F	probably damaging	Het
Zfp820	T	C	17: 21,818,721	Y542C	probably damaging	Het

Other mutations in Afap1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Afap1l2	APN	19	57002308	splice site	probably benign
IGL01012:Afap1l2	APN	19	56930261	missense	probably damaging	0.98
IGL01089:Afap1l2	APN	19	56913411	splice site	probably null
IGL01150:Afap1l2	APN	19	56930186	missense	probably damaging	0.99
IGL02393:Afap1l2	APN	19	56914440	missense	probably damaging	1.00
IGL02887:Afap1l2	APN	19	56920563	missense	probably damaging	1.00
IGL03060:Afap1l2	APN	19	56914250	nonsense	probably null
R0102:Afap1l2	UTSW	19	56928440	unclassified	probably benign
R0102:Afap1l2	UTSW	19	56928440	unclassified	probably benign
R0282:Afap1l2	UTSW	19	56916221	missense	possibly damaging	0.65
R0388:Afap1l2	UTSW	19	56917242	splice site	probably benign
R0432:Afap1l2	UTSW	19	56917119	splice site	probably benign
R0497:Afap1l2	UTSW	19	56930209	missense	probably benign	0.27
R0578:Afap1l2	UTSW	19	56915782	missense	probably benign	0.04
R0631:Afap1l2	UTSW	19	56916085	missense	probably benign	0.39
R0670:Afap1l2	UTSW	19	56915803	missense	probably damaging	1.00
R1188:Afap1l2	UTSW	19	56925069	missense	probably damaging	0.97
R1236:Afap1l2	UTSW	19	56916472	missense	possibly damaging	0.64
R1274:Afap1l2	UTSW	19	56914563	missense	probably benign	0.02
R1463:Afap1l2	UTSW	19	56930151	missense	probably benign	0.01
R1497:Afap1l2	UTSW	19	56928311	missense	probably benign	0.25
R1597:Afap1l2	UTSW	19	56914449	missense	probably benign	0.14
R1778:Afap1l2	UTSW	19	56916206	missense	possibly damaging	0.68
R1795:Afap1l2	UTSW	19	56928409	missense	probably damaging	1.00
R1991:Afap1l2	UTSW	19	57002267	missense	possibly damaging	0.62
R2113:Afap1l2	UTSW	19	56913389	missense	possibly damaging	0.95
R2242:Afap1l2	UTSW	19	56914468	missense	possibly damaging	0.56
R3429:Afap1l2	UTSW	19	56915806	missense	probably damaging	1.00
R3430:Afap1l2	UTSW	19	56915806	missense	probably damaging	1.00
R3698:Afap1l2	UTSW	19	56916523	missense	possibly damaging	0.69
R4706:Afap1l2	UTSW	19	56937240	missense	possibly damaging	0.76
R4956:Afap1l2	UTSW	19	56943447	missense	probably benign	0.00
R4993:Afap1l2	UTSW	19	56918040	missense	probably damaging	1.00
R5878:Afap1l2	UTSW	19	56915675	missense	probably benign	0.01
R6194:Afap1l2	UTSW	19	56922951	missense	probably damaging	1.00
R6226:Afap1l2	UTSW	19	56916128	missense	probably benign	0.00
R6334:Afap1l2	UTSW	19	56917976	splice site	probably null
R6439:Afap1l2	UTSW	19	56928386	missense	possibly damaging	0.91
R7332:Afap1l2	UTSW	19	56918121	missense	probably damaging	1.00
R7524:Afap1l2	UTSW	19	56918111	missense	probably damaging	1.00
R7577:Afap1l2	UTSW	19	56944767	missense	probably damaging	1.00
R7696:Afap1l2	UTSW	19	56914486	missense	probably damaging	1.00
R7741:Afap1l2	UTSW	19	56914482	missense	probably damaging	1.00
R7940:Afap1l2	UTSW	19	56914165	missense	probably damaging	0.99
R8221:Afap1l2	UTSW	19	56914392	missense	probably damaging	1.00
R9037:Afap1l2	UTSW	19	56929971	unclassified	probably benign
R9114:Afap1l2	UTSW	19	56917995	missense	probably damaging	1.00
R9201:Afap1l2	UTSW	19	56928256	missense	probably damaging	1.00
R9623:Afap1l2	UTSW	19	56918030	missense	probably damaging	1.00
R9674:Afap1l2	UTSW	19	56933763	missense	probably damaging	0.96
X0062:Afap1l2	UTSW	19	56918033	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGACCCAACACTGTAGCAG -3'
(R):5'- TGGGAATAGCTGACTTGGCC -3'

Sequencing Primer
(F):5'- CAGAACCTGGCAAAGCATAAAG -3'
(R):5'- ACCTGTATACATGTGTGTACCTG -3'

Posted On

2016-11-21