Incidental Mutation 'R7722:Stc1'
ID595298
Institutional Source Beutler Lab
Gene Symbol Stc1
Ensembl Gene ENSMUSG00000014813
Gene Namestanniocalcin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R7722 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location69029238-69041804 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69032280 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 103 (I103N)
Ref Sequence ENSEMBL: ENSMUSP00000014957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014957]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014957
AA Change: I103N

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000014957
Gene: ENSMUSG00000014813
AA Change: I103N

DomainStartEndE-ValueType
Pfam:Stanniocalcin 6 206 1.6e-104 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conserved cysteine residues and is phosphorylated by protein kinase C exclusively on its serine residues. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Overexpression of human stanniocalcin 1 in mice produces high serum phosphate levels, dwarfism, and increased metabolic rate. This gene has altered expression in hepatocellular, ovarian, and breast cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn A G 17: 13,808,969 E151G probably benign Het
Alpk2 A T 18: 65,350,157 L260H probably damaging Het
Amh T C 10: 80,806,624 V247A probably benign Het
Ank2 T A 3: 127,029,302 I431L probably benign Het
Ano7 G A 1: 93,390,423 A286T probably damaging Het
Atp8a1 T A 5: 67,622,698 probably null Het
Brd1 A T 15: 88,729,559 S378T probably damaging Het
Cd163l1 C A 7: 140,222,386 C209* probably null Het
Clrn1 T A 3: 58,846,334 N202I possibly damaging Het
Cspp1 T C 1: 10,074,901 V308A probably benign Het
Cyp2a5 T C 7: 26,837,118 L174P probably benign Het
Ehbp1 G A 11: 22,089,572 H843Y probably null Het
Fancm T A 12: 65,106,461 D1230E probably damaging Het
Fbxl17 A T 17: 63,356,828 N555K probably damaging Het
Fmnl2 A C 2: 53,054,467 S153R Het
Fras1 G A 5: 96,769,554 V3478M probably damaging Het
Gnptab T C 10: 88,379,528 F37S probably damaging Het
Gpr183 T G 14: 121,954,858 I84L probably damaging Het
Hcn1 A G 13: 117,902,778 H410R unknown Het
Hmcn1 A G 1: 150,667,880 V2848A probably damaging Het
Hmcn2 A T 2: 31,382,500 R1331* probably null Het
Hsd17b4 A C 18: 50,146,524 N190T probably damaging Het
Kif14 A G 1: 136,468,295 D113G probably benign Het
Kmt2e T G 5: 23,497,018 D881E probably benign Het
Lamb1 T A 12: 31,323,571 L1481Q probably damaging Het
Limk2 T C 11: 3,356,092 probably null Het
Luc7l2 T A 6: 38,603,308 S281T unknown Het
Map3k5 A G 10: 20,132,145 D1240G probably benign Het
Med13l C A 5: 118,747,407 T1475K probably benign Het
Med17 G T 9: 15,271,691 Q353K probably benign Het
Mlh3 A G 12: 85,267,492 V640A probably benign Het
Mms22l T A 4: 24,517,201 Y361N probably damaging Het
Mtmr2 T A 9: 13,804,808 N532K probably benign Het
Mtss1 G A 15: 59,055,086 T47I probably damaging Het
Mturn T C 6: 54,699,560 probably null Het
Muc20 A C 16: 32,797,386 S3A probably benign Het
Nde1 T C 16: 14,190,264 Y164H unknown Het
Neurl1b A G 17: 26,441,158 T451A probably benign Het
Olfr1537 A T 9: 39,237,589 Y278* probably null Het
Olfr654 C A 7: 104,588,298 Q165K possibly damaging Het
Pgap3 G A 11: 98,390,784 A196V probably benign Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sdcbp T A 4: 6,385,063 V94E possibly damaging Het
Sgo2a T G 1: 58,016,537 F627V probably benign Het
Skor2 A C 18: 76,862,644 N889T probably benign Het
Slc35f4 A T 14: 49,306,274 N288K probably benign Het
Slc9b2 T A 3: 135,329,835 V355E probably null Het
Smarcc2 A G 10: 128,481,728 E566G possibly damaging Het
Sorcs2 T C 5: 36,043,527 E559G probably damaging Het
Sphkap T C 1: 83,278,921 D369G probably benign Het
Ssfa2 T C 2: 79,662,345 S1079P probably damaging Het
Stx8 T C 11: 68,203,718 V219A probably damaging Het
Tg C T 15: 66,764,309 R582C possibly damaging Het
Tshz2 T A 2: 169,885,272 L596Q probably benign Het
Tti1 A G 2: 158,007,607 Y571H probably benign Het
Zbtb40 A G 4: 136,991,518 I956T probably damaging Het
Zfp990 A C 4: 145,536,962 N177H possibly damaging Het
Other mutations in Stc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01328:Stc1 APN 14 69038277 missense probably benign 0.21
IGL01918:Stc1 APN 14 69031654 splice site probably benign
R0318:Stc1 UTSW 14 69038418 missense probably damaging 0.98
R0322:Stc1 UTSW 14 69029409 missense probably benign 0.08
R1699:Stc1 UTSW 14 69038327 missense probably benign 0.00
R2005:Stc1 UTSW 14 69031647 critical splice donor site probably null
R3801:Stc1 UTSW 14 69038475 missense probably benign
R3803:Stc1 UTSW 14 69038475 missense probably benign
R4184:Stc1 UTSW 14 69029385 start gained probably benign
R5206:Stc1 UTSW 14 69031599 missense probably damaging 1.00
R5927:Stc1 UTSW 14 69032373 missense probably benign 0.02
R6059:Stc1 UTSW 14 69032438 missense probably damaging 1.00
R6185:Stc1 UTSW 14 69038364 missense probably damaging 1.00
R8001:Stc1 UTSW 14 69038395 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GAGCTGAGTGTTCAAGATAGTCC -3'
(R):5'- ACTCTGGTTATGGTGGCCAAC -3'

Sequencing Primer
(F):5'- CTGAGTGTTCAAGATAGTCCAAGAG -3'
(R):5'- CCCCCATGCTGTGAAGAAGAG -3'
Posted On2019-11-12