Incidental Mutation 'R0067:Tie1'
ID59634
Institutional Source Beutler Lab
Gene Symbol Tie1
Ensembl Gene ENSMUSG00000033191
Gene Nametyrosine kinase with immunoglobulin-like and EGF-like domains 1
SynonymsTIE, D430008P04Rik, tie-1
MMRRC Submission 038358-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0067 (G1)
Quality Score179
Status Validated
Chromosome4
Chromosomal Location118471191-118490061 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 118476280 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047421] [ENSMUST00000184261]
Predicted Effect probably benign
Transcript: ENSMUST00000047421
SMART Domains Protein: ENSMUSP00000037129
Gene: ENSMUSG00000033191

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
FN3 640 722 6.95e-10 SMART
transmembrane domain 760 782 N/A INTRINSIC
TyrKc 835 1103 5.05e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153286
Predicted Effect probably benign
Transcript: ENSMUST00000184261
SMART Domains Protein: ENSMUSP00000139279
Gene: ENSMUSG00000033191

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic or neonatal lethality, hemorrhages, edema, increased vascular branching, and abnormal vascular endothelial cell development. Mice homozygous for a hypomorphic allele exhibit dilated and disorganized lymphatic vessel, edema, and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn4 C T 7: 28,911,570 V248M possibly damaging Het
Adamts9 T A 6: 92,890,167 K79N probably damaging Het
AW209491 A T 13: 14,637,743 I394F probably benign Het
C130026I21Rik T A 1: 85,270,052 N5Y probably benign Het
Cacna1d A T 14: 30,075,010 probably benign Het
Cacna1i A T 15: 80,381,172 I1542F probably damaging Het
Cep97 A T 16: 55,915,561 N291K possibly damaging Het
Clasp2 A T 9: 113,860,141 probably benign Het
Coq8b T C 7: 27,233,481 L5P possibly damaging Het
Dennd1c T C 17: 57,075,465 Q67R probably damaging Het
Dysf T C 6: 84,063,331 V119A possibly damaging Het
Eml1 A G 12: 108,463,527 D23G possibly damaging Het
Eva1c A T 16: 90,866,417 D13V possibly damaging Het
Fam151b T C 13: 92,473,996 K95R probably benign Het
Glo1 A T 17: 30,594,271 probably null Het
Gm11360 T A 13: 27,956,231 M26K probably benign Het
Gps2 C T 11: 69,914,781 Q42* probably null Het
Gypa A G 8: 80,503,081 H102R possibly damaging Het
Hdac4 G A 1: 92,029,984 H103Y probably damaging Het
Hivep1 T A 13: 42,158,656 D1457E probably benign Het
Hunk A G 16: 90,447,312 D110G probably damaging Het
L3mbtl1 A G 2: 162,948,828 K225E probably damaging Het
Limch1 A G 5: 66,974,622 S143G probably damaging Het
Macf1 T C 4: 123,475,248 K342E possibly damaging Het
Mc5r T A 18: 68,339,566 M332K probably damaging Het
Memo1 A G 17: 74,225,458 V185A probably damaging Het
Myf6 A T 10: 107,493,479 probably null Het
Myh14 G A 7: 44,623,127 T1418I probably benign Het
Pbk G A 14: 65,815,226 V173I possibly damaging Het
Plekha5 C T 6: 140,524,903 T90I probably damaging Het
Ptbp2 T C 3: 119,720,641 T478A probably benign Het
Rasgrp1 C A 2: 117,294,820 R246S probably damaging Het
Rflnb A T 11: 76,022,161 S134T possibly damaging Het
Rnf214 A G 9: 45,867,498 probably null Het
Rps6ka5 T A 12: 100,616,083 I177F probably damaging Het
Rtn2 T A 7: 19,294,471 probably benign Het
Satb1 T C 17: 51,804,336 T165A probably damaging Het
Scamp1 T C 13: 94,204,150 Y237C probably damaging Het
Skint10 A T 4: 112,711,556 F321L probably benign Het
Skiv2l2 C T 13: 112,886,862 V727I probably benign Het
Slc36a2 A G 11: 55,162,640 probably benign Het
Slc8a1 A G 17: 81,437,759 V672A probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Spats2 C A 15: 99,212,287 P522T possibly damaging Het
Stkld1 A T 2: 26,949,340 E339D probably benign Het
Tbc1d9 A G 8: 83,234,243 T241A probably damaging Het
Ticrr A T 7: 79,677,410 D622V probably damaging Het
Trak1 G C 9: 121,472,907 V910L probably damaging Het
Trmt1l T C 1: 151,448,380 V326A probably benign Het
Tshr A G 12: 91,505,283 T136A probably damaging Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Unc13a A C 8: 71,634,658 F1482V probably damaging Het
Unc79 A G 12: 103,059,518 E388G probably damaging Het
Ush2a A T 1: 188,964,846 D5167V probably damaging Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy4 G A 14: 33,162,751 R65C probably null Het
Zcchc9 T C 13: 91,797,249 I72V probably benign Het
Zfc3h1 G T 10: 115,423,474 L1650F possibly damaging Het
Zzz3 A G 3: 152,428,403 D366G possibly damaging Het
Other mutations in Tie1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tie1 APN 4 118476098 missense probably damaging 1.00
IGL01679:Tie1 APN 4 118482739 missense probably benign 0.00
IGL01821:Tie1 APN 4 118484638 missense probably damaging 0.99
IGL01892:Tie1 APN 4 118475918 missense probably benign
IGL02101:Tie1 APN 4 118472798 missense probably benign 0.42
IGL02411:Tie1 APN 4 118486563 nonsense probably null
IGL02421:Tie1 APN 4 118486394 missense probably damaging 1.00
IGL02892:Tie1 APN 4 118486282 missense probably damaging 1.00
IGL03294:Tie1 APN 4 118480223 missense probably damaging 1.00
IGL03346:Tie1 APN 4 118472828 missense probably damaging 1.00
R0064:Tie1 UTSW 4 118489701 missense possibly damaging 0.94
R0080:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0082:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0098:Tie1 UTSW 4 118486587 missense probably benign
R0329:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0330:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0410:Tie1 UTSW 4 118480569 missense probably damaging 1.00
R0472:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0498:Tie1 UTSW 4 118479161 utr 3 prime probably benign
R0521:Tie1 UTSW 4 118476146 missense probably damaging 1.00
R0609:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0675:Tie1 UTSW 4 118479769 nonsense probably null
R0830:Tie1 UTSW 4 118482663 missense probably damaging 1.00
R1541:Tie1 UTSW 4 118483873 missense probably damaging 0.99
R1604:Tie1 UTSW 4 118474407 missense probably damaging 1.00
R1731:Tie1 UTSW 4 118476263 missense probably damaging 1.00
R1751:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1767:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1953:Tie1 UTSW 4 118472790 critical splice donor site probably null
R1986:Tie1 UTSW 4 118478963 missense probably benign
R2141:Tie1 UTSW 4 118472811 nonsense probably null
R3150:Tie1 UTSW 4 118475825 missense probably damaging 1.00
R4235:Tie1 UTSW 4 118478405 nonsense probably null
R4599:Tie1 UTSW 4 118472634 missense probably benign 0.00
R4614:Tie1 UTSW 4 118479051 missense probably damaging 1.00
R4623:Tie1 UTSW 4 118486611 missense possibly damaging 0.71
R4638:Tie1 UTSW 4 118483842 missense probably benign 0.00
R4717:Tie1 UTSW 4 118486217 missense probably damaging 1.00
R4936:Tie1 UTSW 4 118484771 splice site silent
R4983:Tie1 UTSW 4 118483755 missense probably damaging 1.00
R5202:Tie1 UTSW 4 118480510 missense probably benign 0.01
R5234:Tie1 UTSW 4 118482762 missense probably benign 0.22
R5243:Tie1 UTSW 4 118482351 missense probably damaging 0.99
R5538:Tie1 UTSW 4 118486193 missense probably benign 0.10
R5881:Tie1 UTSW 4 118475603 missense possibly damaging 0.89
R6045:Tie1 UTSW 4 118484691 missense probably benign 0.05
R6073:Tie1 UTSW 4 118482390 missense probably benign
R6476:Tie1 UTSW 4 118472865 missense possibly damaging 0.82
R6820:Tie1 UTSW 4 118484386 missense probably damaging 1.00
R6961:Tie1 UTSW 4 118486205 missense probably damaging 1.00
R7022:Tie1 UTSW 4 118489653 missense probably benign 0.00
R7029:Tie1 UTSW 4 118484626 missense possibly damaging 0.93
R7147:Tie1 UTSW 4 118484413 missense probably damaging 1.00
R7249:Tie1 UTSW 4 118486228 missense probably benign 0.29
R7410:Tie1 UTSW 4 118479877 missense probably benign
R7486:Tie1 UTSW 4 118479904 critical splice acceptor site probably null
Z1088:Tie1 UTSW 4 118484429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTTGATGGCTGCGTTCATCTTG -3'
(R):5'- AACTTACCCATGAACCTGGGCTCC -3'

Sequencing Primer
(F):5'- GCGTTCATCTTGAGCCCG -3'
(R):5'- GAATGATGCCCTCTGCATTTG -3'
Posted On2013-07-11