Incidental Mutation 'R7800:Clcnkb'
ID600468
Institutional Source Beutler Lab
Gene Symbol Clcnkb
Ensembl Gene ENSMUSG00000006216
Gene Namechloride channel, voltage-sensitive Kb
SynonymsClcnk1l, Clck2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7800 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location141404353-141416014 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141414522 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 51 (Y51C)
Ref Sequence ENSEMBL: ENSMUSP00000006378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006378] [ENSMUST00000105788]
Predicted Effect probably benign
Transcript: ENSMUST00000006378
AA Change: Y51C

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000006378
Gene: ENSMUSG00000006216
AA Change: Y51C

DomainStartEndE-ValueType
Pfam:Voltage_CLC 102 514 1.5e-77 PFAM
CBS 554 604 1.77e-2 SMART
Blast:CBS 629 678 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105788
AA Change: Y51C

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101414
Gene: ENSMUSG00000006216
AA Change: Y51C

DomainStartEndE-ValueType
Pfam:Voltage_CLC 102 514 3.6e-72 PFAM
CBS 554 604 1.77e-2 SMART
Pfam:CBS 623 676 3.3e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene is a member of the CLC family of voltage-gated chloride channels. The gene is located adjacent to a highly similar chloride channel gene on chromosome 4. This gene is syntenic with human CLCNKA (geneID:1187). [provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,187,872 D1264G probably benign Het
Ace T C 11: 105,986,058 F1122S probably damaging Het
Actr10 T G 12: 70,943,509 Y112D probably benign Het
Cacnb1 T G 11: 98,009,295 I346L possibly damaging Het
Camsap2 T C 1: 136,281,901 T607A probably damaging Het
Cby3 T C 11: 50,359,348 F32S probably damaging Het
Cers5 G T 15: 99,736,241 H409N probably benign Het
Ces1h A T 8: 93,379,694 L11H Het
Cnnm2 A G 19: 46,877,981 E856G probably benign Het
Cnot1 A G 8: 95,765,062 V378A probably benign Het
Crisp4 A C 1: 18,128,749 S154A probably benign Het
Ddx58 T C 4: 40,211,618 E650G probably benign Het
Disp1 C T 1: 183,098,986 R241Q probably benign Het
Ermard G A 17: 15,056,803 R429H probably benign Het
Extl1 C T 4: 134,371,618 G34D probably benign Het
Gen1 T C 12: 11,241,862 D707G probably benign Het
Hist1h1d C A 13: 23,555,367 T93N possibly damaging Het
Igkv5-37 A C 6: 69,963,515 S48R possibly damaging Het
Ilvbl C T 10: 78,583,975 A571V possibly damaging Het
Itgb1 A G 8: 128,713,237 K136E possibly damaging Het
Lhx8 A G 3: 154,321,647 F253L probably damaging Het
Naa25 A G 5: 121,424,531 T459A possibly damaging Het
Nr3c2 A G 8: 76,909,992 Y574C probably damaging Het
Nrxn1 C T 17: 91,089,207 probably benign Het
Ntrk3 T A 7: 78,302,740 R576S probably benign Het
Nup210l A G 3: 90,134,597 Y403C probably damaging Het
Olfr693 A G 7: 106,677,574 V304A probably benign Het
Olfr920 T G 9: 38,756,618 L310W probably damaging Het
Otogl T A 10: 107,886,515 Y326F probably damaging Het
Pcdha1 T A 18: 36,931,373 D363E probably damaging Het
Pcdhb3 T A 18: 37,301,921 N313K probably benign Het
Pcdhb9 A C 18: 37,401,549 S199R probably benign Het
Pde4dip C T 3: 97,715,283 D1537N probably damaging Het
Pinx1 A G 14: 63,919,535 K304E probably benign Het
Pnlip T C 19: 58,681,702 V458A probably benign Het
Polr3a C A 14: 24,484,387 M60I probably null Het
Qrich2 G T 11: 116,456,860 S1046* probably null Het
Rps6ka5 G A 12: 100,558,565 P638S probably damaging Het
Slc6a13 T A 6: 121,321,699 N158K probably damaging Het
Sord T C 2: 122,259,080 V187A probably damaging Het
Sult2a2 A G 7: 13,734,785 T59A probably benign Het
Thbs2 T C 17: 14,676,296 D777G probably damaging Het
Tmed9 A G 13: 55,595,532 D159G probably benign Het
Trbc1 A G 6: 41,539,261 I142V Het
Usp17ld A G 7: 103,250,834 V297A probably damaging Het
Vmn1r167 A T 7: 23,504,644 *316R probably null Het
Wdr59 C A 8: 111,521,938 R15L Het
Zfp189 C T 4: 49,529,367 P157S possibly damaging Het
Zfp407 C T 18: 84,560,675 G771D probably damaging Het
Other mutations in Clcnkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02430:Clcnkb APN 4 141409390 missense possibly damaging 0.85
IGL02750:Clcnkb APN 4 141405362 critical splice acceptor site probably null
IGL02894:Clcnkb APN 4 141407819 missense probably benign 0.00
R0193:Clcnkb UTSW 4 141412316 missense possibly damaging 0.60
R1427:Clcnkb UTSW 4 141405309 missense probably damaging 1.00
R1555:Clcnkb UTSW 4 141411739 splice site probably null
R1572:Clcnkb UTSW 4 141407095 missense possibly damaging 0.58
R1756:Clcnkb UTSW 4 141415214 missense possibly damaging 0.77
R1776:Clcnkb UTSW 4 141415189 splice site probably benign
R1879:Clcnkb UTSW 4 141407819 missense possibly damaging 0.95
R2149:Clcnkb UTSW 4 141408017 missense probably damaging 1.00
R2180:Clcnkb UTSW 4 141409508 unclassified probably null
R2307:Clcnkb UTSW 4 141412329 missense probably damaging 1.00
R4393:Clcnkb UTSW 4 141412236 missense probably benign 0.00
R4758:Clcnkb UTSW 4 141407849 missense probably benign 0.00
R5416:Clcnkb UTSW 4 141413900 missense probably benign 0.33
R5906:Clcnkb UTSW 4 141412299 missense probably benign
R6185:Clcnkb UTSW 4 141414514 missense probably benign 0.00
R6299:Clcnkb UTSW 4 141410723 missense probably damaging 1.00
R6803:Clcnkb UTSW 4 141405328 missense probably benign
R6877:Clcnkb UTSW 4 141404832 missense probably benign 0.00
R7205:Clcnkb UTSW 4 141408635 missense probably damaging 1.00
R7330:Clcnkb UTSW 4 141410612 missense possibly damaging 0.67
R7332:Clcnkb UTSW 4 141413932 missense probably null 0.83
R7393:Clcnkb UTSW 4 141409445 missense probably benign
R7889:Clcnkb UTSW 4 141410604 missense probably benign 0.00
R7972:Clcnkb UTSW 4 141410604 missense probably benign 0.00
Z1177:Clcnkb UTSW 4 141407951 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGTAAGGGTCAGCTCCAGG -3'
(R):5'- GATCCTCATGTAAGGCAGAGTCC -3'

Sequencing Primer
(F):5'- GGCCACTCACAGCCTTATC -3'
(R):5'- GTAAGGCAGAGTCCCTCGTCATTAC -3'
Posted On2019-11-26