Incidental Mutation 'R7830:Tfrc'
ID602399
Institutional Source Beutler Lab
Gene Symbol Tfrc
Ensembl Gene ENSMUSG00000022797
Gene Nametransferrin receptor
SynonymsMtvr-1, E430033M20Rik, Mtvr1, Trfr, 2610028K12Rik, p90, TfR1, CD71
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7830 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location32608920-32632794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32619167 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 346 (K346R)
Ref Sequence ENSEMBL: ENSMUSP00000023486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023486] [ENSMUST00000120680]
Predicted Effect probably benign
Transcript: ENSMUST00000023486
AA Change: K346R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023486
Gene: ENSMUSG00000022797
AA Change: K346R

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:PA 229 348 1.1e-12 PFAM
Pfam:Peptidase_M28 390 597 1e-13 PFAM
Pfam:TFR_dimer 640 753 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120680
AA Change: K346R

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113028
Gene: ENSMUSG00000022797
AA Change: K346R

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:PA 225 349 9.2e-11 PFAM
Pfam:Peptidase_M28 403 502 3.5e-7 PFAM
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a cell surface receptor necessary for cellular iron uptake by the process of receptor-mediated endocytosis. This receptor is required for erythropoiesis and neurologic development. Mice that are deficient in this receptor show impaired erythroid development and abnormal iron homeostasis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant embryos do not survive past E12.5, exhibiting anemia, hydrops fetalis, and neurological defects. Haploinsufficiency results in abnromal erythrocytes and tissue iron deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,168,871 N24S probably benign Het
4932438A13Rik CCAGATTCATGTAGCA CCA 3: 36,964,932 probably null Het
Adat3 T C 10: 80,606,820 L164P probably damaging Het
Aldh16a1 A T 7: 45,146,225 L388Q probably damaging Het
Angpt1 T C 15: 42,676,268 N65S probably damaging Het
Ankrd54 G A 15: 79,054,050 T287I probably damaging Het
Cc2d2b T A 19: 40,765,357 V108E possibly damaging Het
Cntnap5c A T 17: 58,162,250 D609V probably damaging Het
Col6a4 G T 9: 106,075,390 D436E probably damaging Het
Cul9 A T 17: 46,540,311 D394E probably benign Het
Cyfip1 A G 7: 55,873,462 E75G probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Eif2ak2 C T 17: 78,866,403 G249S probably damaging Het
Erich4 A T 7: 25,615,724 M42K probably benign Het
Fig4 A C 10: 41,256,466 V448G probably benign Het
Gas1 T C 13: 60,176,034 D303G probably damaging Het
Gm609 A T 16: 45,442,554 I187N probably damaging Het
Golgb1 T G 16: 36,898,721 Y330D possibly damaging Het
Gpr146 C T 5: 139,392,602 A53V probably benign Het
Klk1b27 A C 7: 44,055,726 M106L probably benign Het
Lipc T C 9: 70,812,901 T190A probably damaging Het
Lrrc4b A G 7: 44,461,807 I368V possibly damaging Het
Mmp10 A T 9: 7,507,283 Q368L probably benign Het
Myo10 T A 15: 25,737,971 Y501* probably null Het
Neb T A 2: 52,165,189 H6445L probably benign Het
Numa1 T A 7: 101,999,285 M741K probably benign Het
Nxn T A 11: 76,273,993 I231F probably damaging Het
Olfr1471 T C 19: 13,445,621 L203S probably benign Het
Olfr341 A G 2: 36,479,380 L250P probably damaging Het
Osbp2 A G 11: 3,863,414 S152P probably benign Het
P3h4 T C 11: 100,414,043 T173A probably damaging Het
Pcdh15 C A 10: 74,385,901 R678S probably damaging Het
Pcdhb6 C A 18: 37,336,312 T762K probably benign Het
Pnrc1 G A 4: 33,248,057 P114L probably damaging Het
Ppp3ca T A 3: 136,868,720 S126R probably damaging Het
Prl3d2 C T 13: 27,126,017 T155I probably benign Het
Prune2 C A 19: 17,122,674 N1847K probably benign Het
Psg21 A T 7: 18,647,298 V440E probably damaging Het
Rag1 A G 2: 101,642,059 S913P probably damaging Het
Ros1 T A 10: 52,154,934 H525L probably damaging Het
Scarb1 T C 5: 125,287,383 Y94C probably damaging Het
Serpinb6a T G 13: 33,930,047 D120A probably benign Het
Sik3 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 9: 46,212,057 probably benign Het
Slc39a14 T C 14: 70,310,117 D299G probably benign Het
Sox1 G A 8: 12,396,955 A199T probably damaging Het
Strc T A 2: 121,375,049 I867F probably damaging Het
Usf3 C T 16: 44,219,779 Q1541* probably null Het
Wrn G A 8: 33,269,054 L716F probably damaging Het
Zfp141 G A 7: 42,475,188 T620I probably benign Het
Zfp354b A T 11: 50,923,309 I263K probably benign Het
Zfp804b T A 5: 6,771,124 E646D probably benign Het
Zfp970 G T 2: 177,475,545 C304F probably damaging Het
Other mutations in Tfrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Tfrc APN 16 32624828 critical splice donor site probably null
IGL01553:Tfrc APN 16 32628585 missense probably benign 0.07
IGL01667:Tfrc APN 16 32624443 unclassified probably benign
IGL01761:Tfrc APN 16 32628551 missense probably damaging 1.00
IGL02085:Tfrc APN 16 32621186 missense probably benign 0.14
IGL02093:Tfrc APN 16 32630194 missense probably benign 0.06
IGL02401:Tfrc APN 16 32617181 missense probably damaging 1.00
IGL02548:Tfrc APN 16 32624822 nonsense probably null
IGL02715:Tfrc APN 16 32624371 missense probably benign
IGL03157:Tfrc APN 16 32620405 missense probably benign 0.00
IGL03242:Tfrc APN 16 32630112 missense probably damaging 1.00
IGL03410:Tfrc APN 16 32624831 splice site probably null
R0034:Tfrc UTSW 16 32615396 critical splice donor site probably null
R0098:Tfrc UTSW 16 32623426 missense probably damaging 0.98
R0098:Tfrc UTSW 16 32623426 missense probably damaging 0.98
R0508:Tfrc UTSW 16 32630179 missense probably damaging 1.00
R1474:Tfrc UTSW 16 32626649 missense probably damaging 0.99
R1613:Tfrc UTSW 16 32623375 missense probably damaging 1.00
R1694:Tfrc UTSW 16 32614625 missense probably damaging 0.99
R2430:Tfrc UTSW 16 32626711 missense probably damaging 1.00
R3807:Tfrc UTSW 16 32616826 missense possibly damaging 0.47
R4613:Tfrc UTSW 16 32618657 missense probably damaging 1.00
R4661:Tfrc UTSW 16 32630151 missense probably damaging 0.99
R4974:Tfrc UTSW 16 32618279 missense probably damaging 0.99
R5138:Tfrc UTSW 16 32615209 nonsense probably null
R5668:Tfrc UTSW 16 32623376 missense probably damaging 1.00
R5867:Tfrc UTSW 16 32620412 missense possibly damaging 0.71
R5942:Tfrc UTSW 16 32626715 missense possibly damaging 0.65
R6185:Tfrc UTSW 16 32618272 missense probably benign 0.19
R6417:Tfrc UTSW 16 32630239 missense probably damaging 0.99
R7453:Tfrc UTSW 16 32619049 missense probably damaging 1.00
R7559:Tfrc UTSW 16 32621417 intron probably null
R7791:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7792:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7793:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7832:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7943:Tfrc UTSW 16 32630221 missense probably benign
R7974:Tfrc UTSW 16 32621283 missense probably null 0.89
R7980:Tfrc UTSW 16 32617149 missense probably benign 0.04
R8055:Tfrc UTSW 16 32618656 missense probably benign 0.24
R8215:Tfrc UTSW 16 32625030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACTTCCTGAGTAAGTGTTAGAAC -3'
(R):5'- CACCACAGTAGGAATGCACTG -3'

Sequencing Primer
(F):5'- ATACACACCTGGCTTTCC -3'
(R):5'- TAGCCAACTGCCACTTT -3'
Posted On2019-12-03