Incidental Mutation 'R7974:Tfrc'
ID650803
Institutional Source Beutler Lab
Gene Symbol Tfrc
Ensembl Gene ENSMUSG00000022797
Gene Nametransferrin receptor
SynonymsMtvr-1, E430033M20Rik, Mtvr1, Trfr, 2610028K12Rik, p90, TfR1, CD71
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7974 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location32608920-32632794 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32621283 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 438 (D438G)
Ref Sequence ENSEMBL: ENSMUSP00000023486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023486] [ENSMUST00000120680]
Predicted Effect probably null
Transcript: ENSMUST00000023486
AA Change: D438G

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023486
Gene: ENSMUSG00000022797
AA Change: D438G

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:PA 229 348 1.1e-12 PFAM
Pfam:Peptidase_M28 390 597 1e-13 PFAM
Pfam:TFR_dimer 640 753 3.4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120680
AA Change: D438G

PolyPhen 2 Score 0.829 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113028
Gene: ENSMUSG00000022797
AA Change: D438G

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:PA 225 349 9.2e-11 PFAM
Pfam:Peptidase_M28 403 502 3.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a cell surface receptor necessary for cellular iron uptake by the process of receptor-mediated endocytosis. This receptor is required for erythropoiesis and neurologic development. Mice that are deficient in this receptor show impaired erythroid development and abnormal iron homeostasis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant embryos do not survive past E12.5, exhibiting anemia, hydrops fetalis, and neurological defects. Haploinsufficiency results in abnromal erythrocytes and tissue iron deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,044,973 probably null Het
Adamts19 A T 18: 59,011,022 Q892L possibly damaging Het
Adamts9 A G 6: 92,909,687 probably null Het
AI661453 T C 17: 47,466,081 L244P unknown Het
Ankar C A 1: 72,698,979 E15* probably null Het
Arsi A G 18: 60,912,406 D56G probably damaging Het
Blmh T C 11: 76,965,903 I245T possibly damaging Het
Ccr6 T C 17: 8,256,224 F87S probably damaging Het
Cdc42ep2 T C 19: 5,918,495 K61E probably damaging Het
Celsr1 C T 15: 86,031,030 G914D probably damaging Het
Cep126 T A 9: 8,120,763 K86N probably benign Het
Cfap70 A T 14: 20,420,750 F532I probably damaging Het
Cpsf3 T A 12: 21,308,005 L506Q probably damaging Het
Dct A C 14: 118,039,655 I273S probably damaging Het
Dsel T C 1: 111,860,499 I769V probably benign Het
Dus2 G A 8: 106,036,020 E138K probably benign Het
Emsy A G 7: 98,630,218 S305P possibly damaging Het
Erp27 A T 6: 136,908,065 V245D probably damaging Het
Fez1 C A 9: 36,843,948 T81K probably damaging Het
Gli3 A C 13: 15,726,256 Q1409H probably benign Het
Gm10696 T C 3: 94,175,541 K321R probably benign Het
Hdac9 T C 12: 34,303,220 S664G possibly damaging Het
Hibadh A G 6: 52,557,895 S167P probably benign Het
Hsdl1 A G 8: 119,566,333 V121A probably benign Het
Ighv1-18 A C 12: 114,683,049 I6S possibly damaging Het
Iqcm T A 8: 75,554,892 M1K probably null Het
Itch T C 2: 155,192,159 F417S probably damaging Het
Itpr1 C T 6: 108,523,405 T2653I possibly damaging Het
Kank1 T G 19: 25,424,220 Y1064D probably damaging Het
Kmt2c T C 5: 25,300,563 Q3249R probably damaging Het
Lefty1 T C 1: 180,937,820 C318R probably damaging Het
Lmbr1l C T 15: 98,911,619 V147I probably benign Het
Meig1 C A 2: 3,411,874 E37* probably null Het
Mpp3 A G 11: 102,008,354 probably null Het
Muc3 T C 5: 137,146,816 N2S Het
Mup7 T C 4: 60,067,518 E199G possibly damaging Het
Nol4 G C 18: 22,719,025 Y275* probably null Het
Nrxn1 G A 17: 90,700,779 P429S probably damaging Het
Olfr761 T C 17: 37,952,781 Y81C probably damaging Het
Pfkl A T 10: 77,994,162 F367L probably damaging Het
Pik3cg T C 12: 32,204,032 E652G probably benign Het
Prkag3 A G 1: 74,744,821 I301T probably benign Het
Rcn1 G A 2: 105,393,710 P163L probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc9b1 C T 3: 135,394,030 T437I possibly damaging Het
Smap1 T G 1: 23,849,441 T248P probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spata20 T C 11: 94,484,140 N212S possibly damaging Het
Sphkap A C 1: 83,278,962 C355W probably damaging Het
Spsb1 T A 4: 149,907,109 M1L probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Taar5 G C 10: 23,971,222 D173H possibly damaging Het
Tinag A T 9: 76,999,849 I368K probably benign Het
Tm9sf1 A G 14: 55,636,449 W531R probably damaging Het
Tnc G T 4: 64,000,724 P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 R513G probably damaging Het
Ttc30a1 T C 2: 75,980,344 H465R probably damaging Het
Vat1 A G 11: 101,466,130 S2P probably benign Het
Vmn2r107 C G 17: 20,357,008 P423A probably benign Het
Vmn2r2 T A 3: 64,117,387 E591V probably damaging Het
Vmn2r62 G A 7: 42,764,607 T804I probably damaging Het
Vmn2r62 T A 7: 42,787,857 Y401F probably damaging Het
Vmn2r89 A T 14: 51,456,002 I270F probably damaging Het
Zfp418 T C 7: 7,182,168 F377L possibly damaging Het
Other mutations in Tfrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Tfrc APN 16 32624828 critical splice donor site probably null
IGL01553:Tfrc APN 16 32628585 missense probably benign 0.07
IGL01667:Tfrc APN 16 32624443 unclassified probably benign
IGL01761:Tfrc APN 16 32628551 missense probably damaging 1.00
IGL02085:Tfrc APN 16 32621186 missense probably benign 0.14
IGL02093:Tfrc APN 16 32630194 missense probably benign 0.06
IGL02401:Tfrc APN 16 32617181 missense probably damaging 1.00
IGL02548:Tfrc APN 16 32624822 nonsense probably null
IGL02715:Tfrc APN 16 32624371 missense probably benign
IGL03157:Tfrc APN 16 32620405 missense probably benign 0.00
IGL03242:Tfrc APN 16 32630112 missense probably damaging 1.00
IGL03410:Tfrc APN 16 32624831 splice site probably null
R0034:Tfrc UTSW 16 32615396 critical splice donor site probably null
R0098:Tfrc UTSW 16 32623426 missense probably damaging 0.98
R0098:Tfrc UTSW 16 32623426 missense probably damaging 0.98
R0508:Tfrc UTSW 16 32630179 missense probably damaging 1.00
R1474:Tfrc UTSW 16 32626649 missense probably damaging 0.99
R1613:Tfrc UTSW 16 32623375 missense probably damaging 1.00
R1694:Tfrc UTSW 16 32614625 missense probably damaging 0.99
R2430:Tfrc UTSW 16 32626711 missense probably damaging 1.00
R3807:Tfrc UTSW 16 32616826 missense possibly damaging 0.47
R4613:Tfrc UTSW 16 32618657 missense probably damaging 1.00
R4661:Tfrc UTSW 16 32630151 missense probably damaging 0.99
R4974:Tfrc UTSW 16 32618279 missense probably damaging 0.99
R5138:Tfrc UTSW 16 32615209 nonsense probably null
R5668:Tfrc UTSW 16 32623376 missense probably damaging 1.00
R5867:Tfrc UTSW 16 32620412 missense possibly damaging 0.71
R5942:Tfrc UTSW 16 32626715 missense possibly damaging 0.65
R6185:Tfrc UTSW 16 32618272 missense probably benign 0.19
R6417:Tfrc UTSW 16 32630239 missense probably damaging 0.99
R7453:Tfrc UTSW 16 32619049 missense probably damaging 1.00
R7559:Tfrc UTSW 16 32621417 splice site probably null
R7791:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7792:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7793:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7830:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7832:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7943:Tfrc UTSW 16 32630221 missense probably benign
R7980:Tfrc UTSW 16 32617149 missense probably benign 0.04
R8055:Tfrc UTSW 16 32618656 missense probably benign 0.24
R8215:Tfrc UTSW 16 32625030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGATCCTTAGTTCGGTGC -3'
(R):5'- TTGTGTGAGCCAAGTATCAGG -3'

Sequencing Primer
(F):5'- AGATCCTTAGTTCGGTGCTACTTAG -3'
(R):5'- ACAGATCTGATTGAGTTCCAGGAC -3'
Posted On2020-09-15