Incidental Mutation 'R7830:Nxn'
ID602389
Institutional Source Beutler Lab
Gene Symbol Nxn
Ensembl Gene ENSMUSG00000020844
Gene Namenucleoredoxin
Synonymsl11Jus13
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7830 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location76257198-76399140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76273993 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 231 (I231F)
Ref Sequence ENSEMBL: ENSMUSP00000021204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021204]
Predicted Effect probably damaging
Transcript: ENSMUST00000021204
AA Change: I231F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021204
Gene: ENSMUSG00000020844
AA Change: I231F

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 30 145 5.4e-23 PFAM
Pfam:AhpC-TSA 173 290 4.7e-10 PFAM
Pfam:Thioredoxin_2 189 296 7.1e-11 PFAM
Pfam:Thioredoxin_8 193 287 3.7e-32 PFAM
Pfam:Thioredoxin_6 236 424 8.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin superfamily, a group of small, multifunctional redox-active proteins. Members of this family are characterized by a conserved active motif called the thioredoxin fold that catalyzes disulfide bond formation and isomerization. The encoded protein acts a redox-dependent regulator of the Wnt signaling pathway and is involved in cell growth and differentiation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice die by P1 and exhibit craniofacial bone defects and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik A G 18: 12,168,871 N24S probably benign Het
4932438A13Rik CCAGATTCATGTAGCA CCA 3: 36,964,932 probably null Het
Adat3 T C 10: 80,606,820 L164P probably damaging Het
Aldh16a1 A T 7: 45,146,225 L388Q probably damaging Het
Angpt1 T C 15: 42,676,268 N65S probably damaging Het
Ankrd54 G A 15: 79,054,050 T287I probably damaging Het
Cc2d2b T A 19: 40,765,357 V108E possibly damaging Het
Cntnap5c A T 17: 58,162,250 D609V probably damaging Het
Col6a4 G T 9: 106,075,390 D436E probably damaging Het
Cul9 A T 17: 46,540,311 D394E probably benign Het
Cyfip1 A G 7: 55,873,462 E75G probably damaging Het
Efr3a G A 15: 65,829,830 V198I probably benign Het
Eif2ak2 C T 17: 78,866,403 G249S probably damaging Het
Erich4 A T 7: 25,615,724 M42K probably benign Het
Fig4 A C 10: 41,256,466 V448G probably benign Het
Gas1 T C 13: 60,176,034 D303G probably damaging Het
Gm609 A T 16: 45,442,554 I187N probably damaging Het
Golgb1 T G 16: 36,898,721 Y330D possibly damaging Het
Gpr146 C T 5: 139,392,602 A53V probably benign Het
Klk1b27 A C 7: 44,055,726 M106L probably benign Het
Lipc T C 9: 70,812,901 T190A probably damaging Het
Lrrc4b A G 7: 44,461,807 I368V possibly damaging Het
Mmp10 A T 9: 7,507,283 Q368L probably benign Het
Myo10 T A 15: 25,737,971 Y501* probably null Het
Neb T A 2: 52,165,189 H6445L probably benign Het
Numa1 T A 7: 101,999,285 M741K probably benign Het
Olfr1471 T C 19: 13,445,621 L203S probably benign Het
Olfr341 A G 2: 36,479,380 L250P probably damaging Het
Osbp2 A G 11: 3,863,414 S152P probably benign Het
P3h4 T C 11: 100,414,043 T173A probably damaging Het
Pcdh15 C A 10: 74,385,901 R678S probably damaging Het
Pcdhb6 C A 18: 37,336,312 T762K probably benign Het
Pnrc1 G A 4: 33,248,057 P114L probably damaging Het
Ppp3ca T A 3: 136,868,720 S126R probably damaging Het
Prl3d2 C T 13: 27,126,017 T155I probably benign Het
Prune2 C A 19: 17,122,674 N1847K probably benign Het
Psg21 A T 7: 18,647,298 V440E probably damaging Het
Rag1 A G 2: 101,642,059 S913P probably damaging Het
Ros1 T A 10: 52,154,934 H525L probably damaging Het
Scarb1 T C 5: 125,287,383 Y94C probably damaging Het
Serpinb6a T G 13: 33,930,047 D120A probably benign Het
Sik3 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 9: 46,212,057 probably benign Het
Slc39a14 T C 14: 70,310,117 D299G probably benign Het
Sox1 G A 8: 12,396,955 A199T probably damaging Het
Strc T A 2: 121,375,049 I867F probably damaging Het
Tfrc A G 16: 32,619,167 K346R probably benign Het
Usf3 C T 16: 44,219,779 Q1541* probably null Het
Wrn G A 8: 33,269,054 L716F probably damaging Het
Zfp141 G A 7: 42,475,188 T620I probably benign Het
Zfp354b A T 11: 50,923,309 I263K probably benign Het
Zfp804b T A 5: 6,771,124 E646D probably benign Het
Zfp970 G T 2: 177,475,545 C304F probably damaging Het
Other mutations in Nxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nxn APN 11 76274655 splice site probably benign
IGL01780:Nxn APN 11 76274654 splice site probably benign
IGL02350:Nxn APN 11 76274654 splice site probably benign
IGL02357:Nxn APN 11 76274654 splice site probably benign
IGL02423:Nxn APN 11 76274032 missense probably benign 0.13
R0098:Nxn UTSW 11 76278594 splice site probably benign
R0456:Nxn UTSW 11 76263137 nonsense probably null
R1127:Nxn UTSW 11 76274069 nonsense probably null
R1473:Nxn UTSW 11 76263187 missense possibly damaging 0.93
R1681:Nxn UTSW 11 76272464 missense probably benign 0.03
R1917:Nxn UTSW 11 76261672 splice site probably benign
R1918:Nxn UTSW 11 76261672 splice site probably benign
R2010:Nxn UTSW 11 76398801 missense probably damaging 0.99
R4501:Nxn UTSW 11 76274612 missense probably damaging 0.98
R4827:Nxn UTSW 11 76261592 missense probably benign 0.01
R5029:Nxn UTSW 11 76274530 nonsense probably null
R5078:Nxn UTSW 11 76261607 missense probably damaging 1.00
R6403:Nxn UTSW 11 76399020 missense probably benign 0.22
R7088:Nxn UTSW 11 76263148 missense possibly damaging 0.94
R7478:Nxn UTSW 11 76261552 missense probably damaging 0.97
R7642:Nxn UTSW 11 76272459 missense probably damaging 1.00
X0062:Nxn UTSW 11 76263152 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GTGTTTGCAGGAAGGCTTAC -3'
(R):5'- AGAGGCAAAAGCTTACTTCTGTC -3'

Sequencing Primer
(F):5'- GGCTTACCTCAGCTAATATCCTAGAG -3'
(R):5'- CAAATTGGGTTTGGCCATCCCAG -3'
Posted On2019-12-03