Incidental Mutation 'R5138:Tfrc'
ID396319
Institutional Source Beutler Lab
Gene Symbol Tfrc
Ensembl Gene ENSMUSG00000022797
Gene Nametransferrin receptor
SynonymsMtvr-1, E430033M20Rik, Mtvr1, Trfr, 2610028K12Rik, p90, TfR1, CD71
MMRRC Submission 042724-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5138 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32608920-32632794 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 32615209 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 85 (Y85*)
Ref Sequence ENSEMBL: ENSMUSP00000113028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023486] [ENSMUST00000120680] [ENSMUST00000124243]
Predicted Effect probably null
Transcript: ENSMUST00000023486
AA Change: Y85*
SMART Domains Protein: ENSMUSP00000023486
Gene: ENSMUSG00000022797
AA Change: Y85*

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:PA 229 348 1.1e-12 PFAM
Pfam:Peptidase_M28 390 597 1e-13 PFAM
Pfam:TFR_dimer 640 753 3.4e-11 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120680
AA Change: Y85*
SMART Domains Protein: ENSMUSP00000113028
Gene: ENSMUSG00000022797
AA Change: Y85*

DomainStartEndE-ValueType
transmembrane domain 66 88 N/A INTRINSIC
Pfam:PA 225 349 9.2e-11 PFAM
Pfam:Peptidase_M28 403 502 3.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137901
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155929
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: This gene encodes a cell surface receptor necessary for cellular iron uptake by the process of receptor-mediated endocytosis. This receptor is required for erythropoiesis and neurologic development. Mice that are deficient in this receptor show impaired erythroid development and abnormal iron homeostasis. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutant embryos do not survive past E12.5, exhibiting anemia, hydrops fetalis, and neurological defects. Haploinsufficiency results in abnromal erythrocytes and tissue iron deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C A 9: 46,306,821 probably null Het
Actr10 G A 12: 70,961,879 G362E probably damaging Het
Aldh1a3 T C 7: 66,407,852 T278A probably damaging Het
Arpp21 T A 9: 112,179,084 K116M probably damaging Het
Arrdc3 T C 13: 80,891,065 Y72H probably damaging Het
Atr T C 9: 95,937,596 V2212A probably benign Het
Bcdin3d A G 15: 99,471,051 F89S possibly damaging Het
Cacna1d C A 14: 30,490,972 A44S probably benign Het
Cbx3 A G 6: 51,475,289 E28G probably damaging Het
Cdh23 A T 10: 60,312,282 F2722L probably damaging Het
Clec11a A G 7: 44,304,638 V297A probably benign Het
Clk2 C A 3: 89,175,499 probably benign Het
Clybl T A 14: 122,371,304 C103S possibly damaging Het
Col12a1 T A 9: 79,643,966 N2123Y probably damaging Het
Corin G A 5: 72,339,059 P517L probably damaging Het
Ddhd2 A T 8: 25,727,699 I717N probably damaging Het
Derl2 C A 11: 71,014,564 G31* probably null Het
Dgcr8 A G 16: 18,278,077 V523A probably damaging Het
Dnah8 T C 17: 30,765,597 S3090P probably damaging Het
Dsp C A 13: 38,183,298 H641N probably benign Het
Dsp A T 13: 38,195,845 T1590S possibly damaging Het
Duox2 A T 2: 122,297,531 L57Q probably damaging Het
Etfdh A T 3: 79,623,573 V47D probably benign Het
Exoc1 T C 5: 76,568,075 Y823H probably damaging Het
Fam81a C T 9: 70,099,175 R185K probably benign Het
Fsip2 A G 2: 82,981,424 I2696V probably benign Het
Glis1 GCACACA GCACA 4: 107,623,105 probably null Het
Gm15448 A T 7: 3,824,557 Y200* probably null Het
Gtf3c1 A T 7: 125,647,492 N1548K probably benign Het
Hist1h3b G A 13: 23,752,630 R84H probably damaging Het
Hkdc1 A T 10: 62,398,691 I575N probably damaging Het
Ifi208 A G 1: 173,690,673 I449V probably null Het
Ino80 T C 2: 119,383,421 T1223A probably damaging Het
Kctd9 T C 14: 67,728,748 probably null Het
Khdrbs1 A G 4: 129,741,854 Y103H probably benign Het
Kmt2e A G 5: 23,502,695 H1752R probably damaging Het
Lrp5 T A 19: 3,628,319 Q512L probably benign Het
Map2k5 T C 9: 63,263,158 T293A probably damaging Het
Myo7a C A 7: 98,083,599 R657L probably damaging Het
Myrfl A G 10: 116,796,058 probably null Het
Nfatc2 G A 2: 168,536,309 H258Y probably damaging Het
Nup205 T A 6: 35,225,866 L1336Q probably damaging Het
Olfr1218 T C 2: 89,054,947 I160V probably benign Het
Olfr1436 T C 19: 12,298,776 M119V possibly damaging Het
Olfr419 A G 1: 174,250,829 S33P probably damaging Het
Otog T A 7: 46,250,006 S244T possibly damaging Het
Pcdh17 T G 14: 84,447,209 I372S probably damaging Het
Plagl1 A G 10: 13,128,175 probably benign Het
Pnpla7 T C 2: 25,041,103 F910S possibly damaging Het
Prdm13 G A 4: 21,679,507 P328S unknown Het
Prdm5 C T 6: 65,856,102 Q152* probably null Het
Psat1 A G 19: 15,914,948 F216S possibly damaging Het
Psg21 A T 7: 18,656,528 M1K probably null Het
Rab11fip3 A T 17: 25,991,026 S994T probably benign Het
Rax A G 18: 65,938,318 probably benign Het
Rgs22 A T 15: 36,099,788 S260R probably benign Het
Ryr2 A T 13: 11,660,289 H3317Q probably damaging Het
Sc5d A G 9: 42,255,515 Y243H probably damaging Het
Serpinf1 T C 11: 75,415,028 E178G probably damaging Het
Slc15a3 A T 19: 10,856,005 Y462F probably damaging Het
Slc9b1 G A 3: 135,357,773 probably benign Het
Slit2 C T 5: 48,281,967 P1111S probably damaging Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
Snw1 T C 12: 87,460,435 K204E probably benign Het
Steap1 A G 5: 5,736,486 I317T probably damaging Het
Sval2 A G 6: 41,861,945 N20S probably damaging Het
Tmem87a T C 2: 120,371,545 T412A possibly damaging Het
Utp20 T C 10: 88,747,377 K2705E probably damaging Het
Vmn1r230 A T 17: 20,846,968 K140* probably null Het
Vmn2r62 A T 7: 42,764,816 H734Q possibly damaging Het
Zbtb8os T A 4: 129,346,926 probably benign Het
Zfp608 A T 18: 54,891,799 H1466Q probably damaging Het
Zfp957 C T 14: 79,212,922 C479Y probably damaging Het
Other mutations in Tfrc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Tfrc APN 16 32624828 critical splice donor site probably null
IGL01553:Tfrc APN 16 32628585 missense probably benign 0.07
IGL01667:Tfrc APN 16 32624443 unclassified probably benign
IGL01761:Tfrc APN 16 32628551 missense probably damaging 1.00
IGL02085:Tfrc APN 16 32621186 missense probably benign 0.14
IGL02093:Tfrc APN 16 32630194 missense probably benign 0.06
IGL02401:Tfrc APN 16 32617181 missense probably damaging 1.00
IGL02548:Tfrc APN 16 32624822 nonsense probably null
IGL02715:Tfrc APN 16 32624371 missense probably benign
IGL03157:Tfrc APN 16 32620405 missense probably benign 0.00
IGL03242:Tfrc APN 16 32630112 missense probably damaging 1.00
IGL03410:Tfrc APN 16 32624831 splice site probably null
R0034:Tfrc UTSW 16 32615396 critical splice donor site probably null
R0098:Tfrc UTSW 16 32623426 missense probably damaging 0.98
R0098:Tfrc UTSW 16 32623426 missense probably damaging 0.98
R0508:Tfrc UTSW 16 32630179 missense probably damaging 1.00
R1474:Tfrc UTSW 16 32626649 missense probably damaging 0.99
R1613:Tfrc UTSW 16 32623375 missense probably damaging 1.00
R1694:Tfrc UTSW 16 32614625 missense probably damaging 0.99
R2430:Tfrc UTSW 16 32626711 missense probably damaging 1.00
R3807:Tfrc UTSW 16 32616826 missense possibly damaging 0.47
R4613:Tfrc UTSW 16 32618657 missense probably damaging 1.00
R4661:Tfrc UTSW 16 32630151 missense probably damaging 0.99
R4974:Tfrc UTSW 16 32618279 missense probably damaging 0.99
R5668:Tfrc UTSW 16 32623376 missense probably damaging 1.00
R5867:Tfrc UTSW 16 32620412 missense possibly damaging 0.71
R5942:Tfrc UTSW 16 32626715 missense possibly damaging 0.65
R6185:Tfrc UTSW 16 32618272 missense probably benign 0.19
R6417:Tfrc UTSW 16 32630239 missense probably damaging 0.99
R7453:Tfrc UTSW 16 32619049 missense probably damaging 1.00
R7559:Tfrc UTSW 16 32621417 intron probably null
R7791:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7792:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7793:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7830:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7832:Tfrc UTSW 16 32619167 missense probably benign 0.00
R7943:Tfrc UTSW 16 32630221 missense probably benign
R7974:Tfrc UTSW 16 32621283 missense probably null 0.89
R7980:Tfrc UTSW 16 32617149 missense probably benign 0.04
R8055:Tfrc UTSW 16 32618656 missense probably benign 0.24
R8215:Tfrc UTSW 16 32625030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGTAAGACAAGGTGTGCAC -3'
(R):5'- AGCTTACTTGATGGTGTCAGC -3'

Sequencing Primer
(F):5'- GTGTGCACCCATGTCTTAAACAGG -3'
(R):5'- CTTGATGGTGTCAGCAAACTC -3'
Posted On2016-06-21