Incidental Mutation 'RF043:Btnl10'
ID604927
Institutional Source Beutler Lab
Gene Symbol Btnl10
Ensembl Gene ENSMUSG00000020490
Gene Namebutyrophilin-like 10
SynonymsButr1, BUTR-1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #RF043 (G1)
Quality Score214.458
Status Not validated
Chromosome11
Chromosomal Location58917908-58927158 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CAAA to CAAAAAA at 58923926 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020792] [ENSMUST00000069941] [ENSMUST00000108818] [ENSMUST00000142499]
Predicted Effect probably benign
Transcript: ENSMUST00000020792
SMART Domains Protein: ENSMUSP00000020792
Gene: ENSMUSG00000020490

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069941
SMART Domains Protein: ENSMUSP00000063279
Gene: ENSMUSG00000020490

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 5.5e-7 PFAM
PRY 300 352 1.11e-11 SMART
SPRY 353 474 6.55e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108818
SMART Domains Protein: ENSMUSP00000104446
Gene: ENSMUSG00000020490

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142499
SMART Domains Protein: ENSMUSP00000124234
Gene: ENSMUSG00000020490

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 151 233 1e-8 PFAM
PRY 300 352 1.11e-11 SMART
SPRY 353 474 6.55e-24 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Ankhd1 CGGCGG CGGCGGTGGCGG 18: 36,560,917 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 ACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,411 probably benign Het
Cyb5r4 AGACACACTGCCCAGGGA AGACACACTGCCCAGGGATGTGACCGACACACTGCCCAGGGA 9: 87,040,431 probably benign Het
Dbr1 GAGGAG GAGGAGCAGGAG 9: 99,583,697 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Emid1 G T 11: 5,144,322 P63Q probably damaging Het
Gabre GCTCCG GCTCCGACTCCG X: 72,270,048 probably benign Het
Gar1 AACTGCC A 3: 129,830,688 probably benign Het
Gm10181 GAGAGAGAGAGAGA G 9: 25,089,459 probably null Het
Hic1 GGGA G 11: 75,169,455 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCGTTTTCCTTTT 9: 106,570,613 probably benign Het
Krtap4-2 AGGGGCGGCAGC A 11: 99,634,721 probably null Het
Lmx1b CATCTTGATGCCGTCCAA CA 2: 33,640,509 probably null Het
Lrch1 TGGTGGTG T 14: 74,947,575 probably null Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAAGA 11: 58,390,243 probably benign Het
Mamld1 AGC AGCTGC X: 71,118,835 probably benign Het
Mrgprx1 GAAC GAACAAC 7: 48,021,509 probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA CTTGGCCTCACCTGGGGAATTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA 11: 4,941,016 probably benign Het
Nusap1 AGTGAGGAGCAAGCTGAGA AGTGAGGAGCAAGCTGAGATACACGTTAGCCGTGAGGAGCAAGCTGAGA 2: 119,627,592 probably benign Het
P4ha2 GGTGTTG GG 11: 54,110,250 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Ptms TCCTCCTC TCCTCCTCCTC 6: 124,914,448 probably benign Het
Rassf6 AATGGGGATTC AATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGCCATGGGGATTC 5: 90,608,932 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCAGGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Rgs22 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAA 15: 36,010,836 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCGCTC 12: 26,314,014 probably benign Het
Rpgrip1 GAG GAGAAG 14: 52,149,395 probably benign Het
Sgpp1 ACACAC A 12: 75,722,625 probably null Het
Slc39a4 GTC GTCATCATGATCACCATGGTCACCATGATCGCTGTGTTC 15: 76,614,870 probably benign Het
Spaca1 TCTCGC TCTCGCGCTCGC 4: 34,049,846 probably benign Het
Stard8 GGA GGATGA X: 99,066,520 probably benign Het
Stard8 GA GAGCA X: 99,066,527 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGAAGGGCACTTTCCCAGGGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCGCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tmed6 AGC AGCTCGC 8: 107,061,596 probably null Het
Trappc9 GCTGCTGCTGCTGCTGCTGCTGCTGCT GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCT 15: 72,801,305 probably benign Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Btnl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Btnl10 APN 11 58919315 missense probably damaging 0.98
IGL03368:Btnl10 APN 11 58919386 missense possibly damaging 0.61
FR4304:Btnl10 UTSW 11 58923930 small insertion probably benign
FR4449:Btnl10 UTSW 11 58923928 small insertion probably benign
FR4589:Btnl10 UTSW 11 58923929 small insertion probably benign
FR4737:Btnl10 UTSW 11 58923931 small insertion probably benign
FR4976:Btnl10 UTSW 11 58923929 small insertion probably benign
R0420:Btnl10 UTSW 11 58923451 missense probably damaging 1.00
R1875:Btnl10 UTSW 11 58923760 missense probably damaging 0.97
R1908:Btnl10 UTSW 11 58920541 missense possibly damaging 0.74
R3176:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3177:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3276:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3277:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R4600:Btnl10 UTSW 11 58923600 missense probably benign 0.01
R4611:Btnl10 UTSW 11 58920357 missense probably damaging 1.00
R5447:Btnl10 UTSW 11 58922318 missense probably benign 0.13
R5484:Btnl10 UTSW 11 58923825 missense probably damaging 0.98
R5787:Btnl10 UTSW 11 58920343 missense probably damaging 1.00
R5824:Btnl10 UTSW 11 58923440 missense probably benign 0.05
R5859:Btnl10 UTSW 11 58922312 missense probably benign 0.10
R6109:Btnl10 UTSW 11 58920304 missense probably damaging 0.98
R6123:Btnl10 UTSW 11 58920304 missense probably damaging 0.98
R6318:Btnl10 UTSW 11 58926865 utr 3 prime probably benign
R7064:Btnl10 UTSW 11 58919308 missense possibly damaging 0.74
R7083:Btnl10 UTSW 11 58919137 missense probably damaging 1.00
R7152:Btnl10 UTSW 11 58922397 missense probably benign
R7393:Btnl10 UTSW 11 58923706 missense probably damaging 1.00
R7507:Btnl10 UTSW 11 58920558 missense probably benign 0.05
R7893:Btnl10 UTSW 11 58923809 missense probably benign 0.01
R8485:Btnl10 UTSW 11 58920316 missense possibly damaging 0.92
R8529:Btnl10 UTSW 11 58922412 missense probably benign 0.00
RF018:Btnl10 UTSW 11 58923926 small insertion probably benign
X0064:Btnl10 UTSW 11 58923610 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTACAAGAAGAAACTCCAAGCC -3'
(R):5'- AGAAATCCCTGACCCTGGTG -3'

Sequencing Primer
(F):5'- GACTTGCCTGTCTCCTCCAGAG -3'
(R):5'- GCATTTGGCACAGAAATTTGG -3'
Posted On2019-12-04