Incidental Mutation 'R7507:Btnl10'
ID581857
Institutional Source Beutler Lab
Gene Symbol Btnl10
Ensembl Gene ENSMUSG00000020490
Gene Namebutyrophilin-like 10
SynonymsButr1, BUTR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7507 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58917908-58927158 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58920558 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 236 (T236A)
Ref Sequence ENSEMBL: ENSMUSP00000063279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020792] [ENSMUST00000069941] [ENSMUST00000108818] [ENSMUST00000142499]
Predicted Effect probably benign
Transcript: ENSMUST00000020792
SMART Domains Protein: ENSMUSP00000020792
Gene: ENSMUSG00000020490

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069941
AA Change: T236A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063279
Gene: ENSMUSG00000020490
AA Change: T236A

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 5.5e-7 PFAM
PRY 300 352 1.11e-11 SMART
SPRY 353 474 6.55e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108818
SMART Domains Protein: ENSMUSP00000104446
Gene: ENSMUSG00000020490

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 150 233 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142499
AA Change: T236A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000124234
Gene: ENSMUSG00000020490
AA Change: T236A

DomainStartEndE-ValueType
IGv 49 130 2.62e-7 SMART
Pfam:C2-set_2 151 233 1e-8 PFAM
PRY 300 352 1.11e-11 SMART
SPRY 353 474 6.55e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,675,218 T1359S probably benign Het
Adam8 C T 7: 139,987,178 probably null Het
Adnp2 A G 18: 80,130,853 S114P probably benign Het
BC051019 T A 7: 109,716,268 D260V possibly damaging Het
Cacna1c A T 6: 119,057,239 L109Q Het
Clint1 C A 11: 45,908,949 Q512K possibly damaging Het
Dopey1 A G 9: 86,535,949 N1957S probably benign Het
Gosr1 A T 11: 76,754,414 N101K probably benign Het
Gria1 A G 11: 57,228,939 T350A probably benign Het
Hs3st5 T A 10: 36,833,015 V182D probably damaging Het
Igkv4-80 G T 6: 69,016,693 S71R probably benign Het
Kif2b A G 11: 91,577,443 F5L probably benign Het
Med1 A G 11: 98,158,026 L648P probably damaging Het
Mgat4a G A 1: 37,452,527 L375F probably damaging Het
Mlph A T 1: 90,927,707 probably benign Het
Nbeal1 T C 1: 60,235,467 S346P probably damaging Het
Nhlrc2 G A 19: 56,597,378 V682I not run Het
Nos3 T C 5: 24,372,644 M552T probably damaging Het
Olfr1152 T C 2: 87,868,369 I126T probably damaging Het
Olfr1509 A G 14: 52,450,473 N20S probably benign Het
Olfr799 T A 10: 129,647,497 I123N probably damaging Het
Pcdha5 A T 18: 36,960,856 R139S probably benign Het
Pik3r1 G A 13: 101,708,982 S147L probably benign Het
Plppr4 T A 3: 117,322,105 H701L possibly damaging Het
Pnpla1 T C 17: 28,876,817 Y71H probably damaging Het
Ppp1r12c G A 7: 4,483,971 A521V probably benign Het
Rasgrp3 C A 17: 75,497,060 D119E probably damaging Het
Rnf216 A T 5: 143,089,802 D342E probably damaging Het
Rnpc3 A T 3: 113,616,761 S294T probably benign Het
Sepsecs A G 5: 52,644,055 F422L probably damaging Het
Sgcz T A 8: 37,953,046 E17D probably benign Het
Slc2a5 T C 4: 150,125,650 Y31H probably damaging Het
Spag9 A G 11: 94,068,080 E310G probably benign Het
Stat4 A G 1: 52,078,574 Y288C probably damaging Het
Tet1 A G 10: 62,832,892 probably null Het
Trim62 A G 4: 128,896,871 T154A probably benign Het
Tubb4a T C 17: 57,081,642 D128G probably damaging Het
Ube2cbp G A 9: 86,422,886 A301V possibly damaging Het
Utp6 A G 11: 79,942,186 S444P possibly damaging Het
Vasn T C 16: 4,649,481 C431R probably damaging Het
Zfp260 T C 7: 30,104,866 S64P probably damaging Het
Zfp451 A T 1: 33,769,759 M1007K probably damaging Het
Zfp606 C A 7: 12,492,941 Q330K probably benign Het
Other mutations in Btnl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02033:Btnl10 APN 11 58919315 missense probably damaging 0.98
IGL03368:Btnl10 APN 11 58919386 missense possibly damaging 0.61
FR4304:Btnl10 UTSW 11 58923930 small insertion probably benign
FR4449:Btnl10 UTSW 11 58923928 small insertion probably benign
FR4589:Btnl10 UTSW 11 58923929 small insertion probably benign
FR4737:Btnl10 UTSW 11 58923931 small insertion probably benign
FR4976:Btnl10 UTSW 11 58923929 small insertion probably benign
R0420:Btnl10 UTSW 11 58923451 missense probably damaging 1.00
R1875:Btnl10 UTSW 11 58923760 missense probably damaging 0.97
R1908:Btnl10 UTSW 11 58920541 missense possibly damaging 0.74
R3176:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3177:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3276:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R3277:Btnl10 UTSW 11 58922390 missense probably benign 0.00
R4600:Btnl10 UTSW 11 58923600 missense probably benign 0.01
R4611:Btnl10 UTSW 11 58920357 missense probably damaging 1.00
R5447:Btnl10 UTSW 11 58922318 missense probably benign 0.13
R5484:Btnl10 UTSW 11 58923825 missense probably damaging 0.98
R5787:Btnl10 UTSW 11 58920343 missense probably damaging 1.00
R5824:Btnl10 UTSW 11 58923440 missense probably benign 0.05
R5859:Btnl10 UTSW 11 58922312 missense probably benign 0.10
R6109:Btnl10 UTSW 11 58920304 missense probably damaging 0.98
R6123:Btnl10 UTSW 11 58920304 missense probably damaging 0.98
R6318:Btnl10 UTSW 11 58926865 utr 3 prime probably benign
R7064:Btnl10 UTSW 11 58919308 missense possibly damaging 0.74
R7083:Btnl10 UTSW 11 58919137 missense probably damaging 1.00
R7152:Btnl10 UTSW 11 58922397 missense probably benign
R7393:Btnl10 UTSW 11 58923706 missense probably damaging 1.00
R7893:Btnl10 UTSW 11 58923809 missense probably benign 0.01
R8485:Btnl10 UTSW 11 58920316 missense possibly damaging 0.92
R8529:Btnl10 UTSW 11 58922412 missense probably benign 0.00
R8909:Btnl10 UTSW 11 58922372 missense probably benign 0.00
RF018:Btnl10 UTSW 11 58923926 small insertion probably benign
RF043:Btnl10 UTSW 11 58923926 small insertion probably benign
X0064:Btnl10 UTSW 11 58923610 missense probably damaging 1.00
Z1186:Btnl10 UTSW 11 58919312 missense probably benign
Z1186:Btnl10 UTSW 11 58923927 small insertion probably benign
Z1186:Btnl10 UTSW 11 58926824 missense unknown
Z1187:Btnl10 UTSW 11 58919312 missense probably benign
Z1187:Btnl10 UTSW 11 58923927 small insertion probably benign
Z1187:Btnl10 UTSW 11 58923929 small insertion probably benign
Z1187:Btnl10 UTSW 11 58926824 missense unknown
Z1188:Btnl10 UTSW 11 58919312 missense probably benign
Z1188:Btnl10 UTSW 11 58923927 small insertion probably benign
Z1188:Btnl10 UTSW 11 58926824 missense unknown
Z1189:Btnl10 UTSW 11 58919312 missense probably benign
Z1189:Btnl10 UTSW 11 58923927 small insertion probably benign
Z1189:Btnl10 UTSW 11 58926824 missense unknown
Z1190:Btnl10 UTSW 11 58919312 missense probably benign
Z1190:Btnl10 UTSW 11 58923927 small insertion probably benign
Z1190:Btnl10 UTSW 11 58926824 missense unknown
Z1191:Btnl10 UTSW 11 58919312 missense probably benign
Z1191:Btnl10 UTSW 11 58923927 small insertion probably benign
Z1191:Btnl10 UTSW 11 58923929 small insertion probably benign
Z1191:Btnl10 UTSW 11 58926824 missense unknown
Z1192:Btnl10 UTSW 11 58919312 missense probably benign
Z1192:Btnl10 UTSW 11 58923927 small insertion probably benign
Z1192:Btnl10 UTSW 11 58923928 small insertion probably benign
Z1192:Btnl10 UTSW 11 58923931 small insertion probably benign
Z1192:Btnl10 UTSW 11 58926824 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAGAATCCGTGTGACTGAC -3'
(R):5'- TAGTGGATCTCCCTGCATCC -3'

Sequencing Primer
(F):5'- ACCTCAGCAGGCTGGTAC -3'
(R):5'- CCTATCCCTGCATTGTCTTGGAAAC -3'
Posted On2019-10-17