Incidental Mutation 'RF043:Trappc9'
ID604935
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Nametrafficking protein particle complex 9
SynonymsTRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #RF043 (G1)
Quality Score217.468
Status Not validated
Chromosome15
Chromosomal Location72589620-73061204 bp(-) (GRCm38)
Type of Mutationsmall insertion (5 aa in frame mutation)
DNA Base Change (assembly) GCTGCTGCTGCTGCTGCTGCTGCTGCT to GCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTGCTGCT at 72801305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000170633]
Predicted Effect probably benign
Transcript: ENSMUST00000023276
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089770
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170633
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc2 GCGGCGGCGGCGAC GC 2: 25,272,561 probably benign Het
Ankhd1 CGGCGG CGGCGGTGGCGG 18: 36,560,917 probably benign Het
Btnl10 CAAA CAAAAAA 11: 58,923,926 probably benign Het
Cpne1 TCCAC TC 2: 156,073,510 probably benign Het
Cyb5r4 ACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACACTGCCCAGGGATGTGACAGACGCACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,411 probably benign Het
Cyb5r4 AGACACACTGCCCAGGGA AGACACACTGCCCAGGGATGTGACCGACACACTGCCCAGGGA 9: 87,040,431 probably benign Het
Dbr1 GAGGAG GAGGAGCAGGAG 9: 99,583,697 probably benign Het
Defb22 GCGGCA GCGGCAGAGCTGGCCTTTGCGGCA 2: 152,485,833 probably benign Het
Emid1 G T 11: 5,144,322 P63Q probably damaging Het
Gabre GCTCCG GCTCCGACTCCG X: 72,270,048 probably benign Het
Gar1 AACTGCC A 3: 129,830,688 probably benign Het
Gm10181 GAGAGAGAGAGAGA G 9: 25,089,459 probably null Het
Hic1 GGGA G 11: 75,169,455 probably benign Het
Il2 GG GGGCTTGAAGTGTG 3: 37,125,842 probably benign Het
Iqcf4 CTTTTCCTTTT CTTTTCCTTTTCCTTTTCCTTTTCCTTTTCCTTTTCGTTTTCCTTTT 9: 106,570,613 probably benign Het
Krtap4-2 AGGGGCGGCAGC A 11: 99,634,721 probably null Het
Lmx1b CATCTTGATGCCGTCCAA CA 2: 33,640,509 probably null Het
Lrch1 TGGTGGTG T 14: 74,947,575 probably null Het
Lrmp TG TGAGCACATGG 6: 145,173,790 probably benign Het
Lypd8 CA CAGTTCCCTCGCCTCTGTTACCCCACAAATCACCAAGA 11: 58,390,243 probably benign Het
Mamld1 AGC AGCTGC X: 71,118,835 probably benign Het
Mrgprx1 GAAC GAACAAC 7: 48,021,509 probably benign Het
Nefh CTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA CTTGGCCTCACCTGGGGAATTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGA 11: 4,941,016 probably benign Het
Nusap1 AGTGAGGAGCAAGCTGAGA AGTGAGGAGCAAGCTGAGATACACGTTAGCCGTGAGGAGCAAGCTGAGA 2: 119,627,592 probably benign Het
P4ha2 GGTGTTG GG 11: 54,110,250 probably null Het
Padi3 TCTCAC TC 4: 140,792,972 probably benign Het
Plekhs1 TCCAGAC TCCAGACCTCCCCCCAGAC 19: 56,479,858 probably benign Het
Ptms TCCTCCTC TCCTCCTCCTC 6: 124,914,448 probably benign Het
Rassf6 AATGGGGATTC AATGGGGATTCTGCCTCACTCATGGTCCTGTAGAGCCATGGGGATTC 5: 90,608,932 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCAGGGTCCTGTAGAGCAATGGGGCTTC 5: 90,608,939 probably benign Het
Rgs22 CTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA CAAAAAAAAAAAA 15: 36,010,836 probably benign Het
Rnf144a TCTC TCTCTCTCTCTCTCGCTC 12: 26,314,014 probably benign Het
Rpgrip1 GAG GAGAAG 14: 52,149,395 probably benign Het
Sgpp1 ACACAC A 12: 75,722,625 probably null Het
Slc39a4 GTC GTCATCATGATCACCATGGTCACCATGATCGCTGTGTTC 15: 76,614,870 probably benign Het
Spaca1 TCTCGC TCTCGCGCTCGC 4: 34,049,846 probably benign Het
Stard8 GGA GGATGA X: 99,066,520 probably benign Het
Stard8 GA GAGCA X: 99,066,527 probably benign Het
Tcof1 AGATCCCCTTGGC AGATCCCCTTGGCTGCTGAGAAGGGCACTTTCCCAGGGATCCCCTTGGC 18: 60,833,572 probably benign Het
Tgoln1 TGGGCTTG TGGGCTTGTCAGAATCACCTCCTGCGGGCTTG 6: 72,616,036 probably benign Het
Tgoln1 GCTTGCCAGAAT GCTTGCCAGAATCACCGCCCGTGGTCTTGCCAGAAT 6: 72,616,063 probably benign Het
Tmed6 AGC AGCTCGC 8: 107,061,596 probably null Het
Zfp933 TT TTTGCCT 4: 147,825,731 probably null Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4012:Trappc9 UTSW 15 73031623 missense possibly damaging 0.95
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- AGGTTGGCAGGGTTTGAAAC -3'
(R):5'- GAAACTGGAAATGAGTCACCTG -3'

Sequencing Primer
(F):5'- AACATAGGTTCTGCCCCGC -3'
(R):5'- GCAGCTGTTTAATGTCAGG -3'
Posted On2019-12-04