Incidental Mutation 'RF056:Nusap1'
ID 605260
Institutional Source Beutler Lab
Gene Symbol Nusap1
Ensembl Gene ENSMUSG00000027306
Gene Name nucleolar and spindle associated protein 1
Synonyms 2610201A12Rik, NuSAP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF056 (G1)
Quality Score 217.468
Status Not validated
Chromosome 2
Chromosomal Location 119618298-119651244 bp(+) (GRCm38)
Type of Mutation small insertion (10 aa in frame mutation)
DNA Base Change (assembly) GTTAGCAGTGAGGAGCAAGCTGAGA to GTTAGCAGTGAGGAGCAAGCTGAGATACACTTTAGCAGTGAGGAGCAAGCTGAGA at 119627586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028771] [ENSMUST00000068225]
AlphaFold Q9ERH4
Predicted Effect probably benign
Transcript: ENSMUST00000028771
SMART Domains Protein: ENSMUSP00000028771
Gene: ENSMUSG00000027306

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
coiled coil region 360 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068225
SMART Domains Protein: ENSMUSP00000068713
Gene: ENSMUSG00000027306

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
Pfam:NUSAP 167 261 6e-27 PFAM
Pfam:NUSAP 256 421 2.3e-72 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Early embryos homozygous for a knock-out allele are small and exhibit disorganized embryonic tissue, abnormal chromatin-induced spindle assembly, abnormal inner cell mass apoptosis, and complete embryonic lethality at implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Begain CG CGCCGCAG 12: 109,033,436 probably benign Het
Bhlhb9 C T X: 135,890,490 L484F possibly damaging Het
Cacna1f GA GAGTA X: 7,620,075 probably null Het
Chga GCA GCATCA 12: 102,561,424 probably benign Het
Cnpy3 CCT CCTACT 17: 46,736,744 probably null Het
Cyb5r4 CACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA CACACTGCCCAGGGATGTGACAGAGACACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,410 probably benign Het
Dmkn T TAGAGGTGGAAGTGGTGGAAGTGGTGGA 7: 30,767,207 probably benign Het
Efhd2 GCCGCC GCCGCCTCCGCC 4: 141,874,767 probably benign Het
Fam171b C CAGCAGA 2: 83,812,896 probably benign Het
Fam71e1 CTGAGGGAGGA CTGAGGGAGGAAGGCTGGATCCTGGATACCTGGGTATGAGGGAGGA 7: 44,500,527 probably null Het
Gm10181 GAGAGAGAGAGAGA G 9: 25,089,465 probably null Het
Gm16494 TTT TTTT 17: 47,016,915 probably null Het
Hsdl2 CCACAGCTGCAG CCACAGCTGCAGCAGCAGCACAGCTGCAG 4: 59,610,647 probably null Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nelfe A AGCGGGATCGAGACAGAGACAAAGG 17: 34,854,071 probably benign Het
Ngfr CAGG C 11: 95,587,511 probably benign Het
Olfr964-ps1 A ATAGG 9: 39,686,754 probably null Het
Pdik1l TTGCACC TTGCACCTGCACC 4: 134,279,502 probably benign Het
Pdik1l C CCACCAA 4: 134,279,516 probably benign Het
Pqbp1 ACACACACACACC A X: 7,898,759 probably benign Het
Rbm28 AGCAACACCTCTCACCTGGGGCAGAAGCA AGCAACACCTCTCACCTGGGGCAGAAGCAACACCTCTCACCTGGGGCAGAAGCA 6: 29,157,053 probably null Het
Rnf126 GAGGAC G 10: 79,759,142 probably null Het
Rprd2 CAGAGCCTGTGGTGCTCGCAGG C 3: 95,766,319 probably benign Het
Rtbdn CGG CGGAAGAGG 8: 84,956,170 probably benign Het
Rtbdn GCAGCG GCAGCGCCAGCG 8: 84,956,172 probably benign Het
Sbp ACAAAGATGCTGACA ACAAAGATGCTGACAGCAAAGATGCTGACA 17: 23,945,366 probably benign Het
Setd1a GTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG GTGGTGGTGGTGGTGGTGGTGGTAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGG 7: 127,785,303 probably benign Het
Setd1a TGGTGGTGG TGGTGGTGGGGGTGGTGG 7: 127,785,328 probably benign Het
Sh3pxd2b CCTGTG CCTGTGGCTGTG 11: 32,423,055 probably benign Het
Taf1a CACGTTGAAGCTGTAGGTAAGTGAGACAGCGTTGAAGCTGTAGGTAAGTGAGACA CGCGTTGAAGCTGTAGGTAAGTGAGACA 1: 183,391,029 probably benign Het
Tcof1 TCCCCTTGGC TCCCCTTGGCTGCTGAGATGGGCACTTTCCTAGAGACCCCCTTGGC 18: 60,833,575 probably benign Het
Tsen2 CCAG CCAGCAG 6: 115,560,064 probably benign Het
Unc13b CAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC CAGAGCCAGAGCCAGAGCAAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC 4: 43,177,359 probably benign Het
Zfp384 CCCAGGC CCCAGGCCCAGGGCCAGGC 6: 125,036,490 probably benign Het
Other mutations in Nusap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Nusap1 APN 2 119648890 splice site probably benign
IGL02582:Nusap1 APN 2 119648989 makesense probably null
IGL02732:Nusap1 APN 2 119635580 missense probably damaging 0.96
IGL02794:Nusap1 APN 2 119630386 missense possibly damaging 0.80
R0635:Nusap1 UTSW 2 119627667 missense probably damaging 0.98
R2567:Nusap1 UTSW 2 119643830 missense possibly damaging 0.70
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3895:Nusap1 UTSW 2 119627691 missense possibly damaging 0.94
R4296:Nusap1 UTSW 2 119639648 missense probably damaging 1.00
R5111:Nusap1 UTSW 2 119630356 nonsense probably null
R5417:Nusap1 UTSW 2 119647143 missense probably damaging 0.98
R5754:Nusap1 UTSW 2 119647099 missense probably damaging 1.00
R5818:Nusap1 UTSW 2 119635513 missense possibly damaging 0.85
R6176:Nusap1 UTSW 2 119630421 missense probably benign 0.01
R7947:Nusap1 UTSW 2 119647135 missense possibly damaging 0.95
R9010:Nusap1 UTSW 2 119648975 missense possibly damaging 0.91
R9312:Nusap1 UTSW 2 119627638 small deletion probably benign
R9556:Nusap1 UTSW 2 119648963 missense not run
RF003:Nusap1 UTSW 2 119627603 small insertion probably benign
RF007:Nusap1 UTSW 2 119627581 small insertion probably benign
RF010:Nusap1 UTSW 2 119627584 small insertion probably benign
RF016:Nusap1 UTSW 2 119627601 small insertion probably benign
RF018:Nusap1 UTSW 2 119627578 small insertion probably benign
RF026:Nusap1 UTSW 2 119627590 small insertion probably benign
RF026:Nusap1 UTSW 2 119627604 small insertion probably benign
RF028:Nusap1 UTSW 2 119627578 small insertion probably benign
RF028:Nusap1 UTSW 2 119627591 small insertion probably benign
RF029:Nusap1 UTSW 2 119627594 small insertion probably benign
RF029:Nusap1 UTSW 2 119627605 small insertion probably benign
RF032:Nusap1 UTSW 2 119627587 small insertion probably benign
RF033:Nusap1 UTSW 2 119627600 small insertion probably benign
RF035:Nusap1 UTSW 2 119627579 small insertion probably benign
RF036:Nusap1 UTSW 2 119627587 small insertion probably benign
RF036:Nusap1 UTSW 2 119627594 small insertion probably benign
RF037:Nusap1 UTSW 2 119627589 small insertion probably benign
RF040:Nusap1 UTSW 2 119627587 small insertion probably benign
RF041:Nusap1 UTSW 2 119627579 small insertion probably benign
RF041:Nusap1 UTSW 2 119627593 small insertion probably benign
RF041:Nusap1 UTSW 2 119627607 nonsense probably null
RF042:Nusap1 UTSW 2 119627607 nonsense probably null
RF043:Nusap1 UTSW 2 119627592 small insertion probably benign
RF045:Nusap1 UTSW 2 119627610 small insertion probably benign
RF046:Nusap1 UTSW 2 119627595 nonsense probably null
RF048:Nusap1 UTSW 2 119627599 small insertion probably benign
RF049:Nusap1 UTSW 2 119627583 small insertion probably benign
RF052:Nusap1 UTSW 2 119627584 small insertion probably benign
RF056:Nusap1 UTSW 2 119627581 small insertion probably benign
RF056:Nusap1 UTSW 2 119627591 small insertion probably benign
RF062:Nusap1 UTSW 2 119627601 small insertion probably benign
RF062:Nusap1 UTSW 2 119627610 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCGGACCATCCTGTGTTCATAC -3'
(R):5'- CCAGTCATCTAGCATCATGAAGG -3'

Sequencing Primer
(F):5'- GGACCATCCTGTGTTCATACTGTAAC -3'
(R):5'- CACTAAAAGTGTGCCAGTTATGG -3'
Posted On 2019-12-04