Incidental Mutation 'RF035:Nusap1'
ID 604517
Institutional Source Beutler Lab
Gene Symbol Nusap1
Ensembl Gene ENSMUSG00000027306
Gene Name nucleolar and spindle associated protein 1
Synonyms 2610201A12Rik, NuSAP
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # RF035 (G1)
Quality Score 187.468
Status Not validated
Chromosome 2
Chromosomal Location 119618298-119651244 bp(+) (GRCm38)
Type of Mutation small insertion (10 aa in frame mutation)
DNA Base Change (assembly) GATACACGTTAGCAGTGAGGAGCAAGCTGA to GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA at 119627579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028771] [ENSMUST00000068225]
AlphaFold Q9ERH4
Predicted Effect probably benign
Transcript: ENSMUST00000028771
SMART Domains Protein: ENSMUSP00000028771
Gene: ENSMUSG00000027306

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
coiled coil region 360 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068225
SMART Domains Protein: ENSMUSP00000068713
Gene: ENSMUSG00000027306

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 119 129 N/A INTRINSIC
Pfam:NUSAP 167 261 6e-27 PFAM
Pfam:NUSAP 256 421 2.3e-72 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NUSAP1 is a nucleolar-spindle-associated protein that plays a role in spindle microtubule organization (Raemaekers et al., 2003 [PubMed 12963707]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Early embryos homozygous for a knock-out allele are small and exhibit disorganized embryonic tissue, abnormal chromatin-induced spindle assembly, abnormal inner cell mass apoptosis, and complete embryonic lethality at implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Mamld1 GCAACA GCAACAACA X: 71,118,812 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,838 probably benign Het
Mamld1 AGC AGCGGC X: 71,118,850 probably benign Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in Nusap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Nusap1 APN 2 119648890 splice site probably benign
IGL02582:Nusap1 APN 2 119648989 makesense probably null
IGL02732:Nusap1 APN 2 119635580 missense probably damaging 0.96
IGL02794:Nusap1 APN 2 119630386 missense possibly damaging 0.80
R0635:Nusap1 UTSW 2 119627667 missense probably damaging 0.98
R2567:Nusap1 UTSW 2 119643830 missense possibly damaging 0.70
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3162:Nusap1 UTSW 2 119630404 missense possibly damaging 0.86
R3895:Nusap1 UTSW 2 119627691 missense possibly damaging 0.94
R4296:Nusap1 UTSW 2 119639648 missense probably damaging 1.00
R5111:Nusap1 UTSW 2 119630356 nonsense probably null
R5417:Nusap1 UTSW 2 119647143 missense probably damaging 0.98
R5754:Nusap1 UTSW 2 119647099 missense probably damaging 1.00
R5818:Nusap1 UTSW 2 119635513 missense possibly damaging 0.85
R6176:Nusap1 UTSW 2 119630421 missense probably benign 0.01
R7947:Nusap1 UTSW 2 119647135 missense possibly damaging 0.95
R9010:Nusap1 UTSW 2 119648975 missense possibly damaging 0.91
R9312:Nusap1 UTSW 2 119627638 small deletion probably benign
R9556:Nusap1 UTSW 2 119648963 missense not run
RF003:Nusap1 UTSW 2 119627603 small insertion probably benign
RF007:Nusap1 UTSW 2 119627581 small insertion probably benign
RF010:Nusap1 UTSW 2 119627584 small insertion probably benign
RF016:Nusap1 UTSW 2 119627601 small insertion probably benign
RF018:Nusap1 UTSW 2 119627578 small insertion probably benign
RF026:Nusap1 UTSW 2 119627590 small insertion probably benign
RF026:Nusap1 UTSW 2 119627604 small insertion probably benign
RF028:Nusap1 UTSW 2 119627578 small insertion probably benign
RF028:Nusap1 UTSW 2 119627591 small insertion probably benign
RF029:Nusap1 UTSW 2 119627594 small insertion probably benign
RF029:Nusap1 UTSW 2 119627605 small insertion probably benign
RF032:Nusap1 UTSW 2 119627587 small insertion probably benign
RF033:Nusap1 UTSW 2 119627600 small insertion probably benign
RF036:Nusap1 UTSW 2 119627587 small insertion probably benign
RF036:Nusap1 UTSW 2 119627594 small insertion probably benign
RF037:Nusap1 UTSW 2 119627589 small insertion probably benign
RF040:Nusap1 UTSW 2 119627587 small insertion probably benign
RF041:Nusap1 UTSW 2 119627579 small insertion probably benign
RF041:Nusap1 UTSW 2 119627593 small insertion probably benign
RF041:Nusap1 UTSW 2 119627607 nonsense probably null
RF042:Nusap1 UTSW 2 119627607 nonsense probably null
RF043:Nusap1 UTSW 2 119627592 small insertion probably benign
RF045:Nusap1 UTSW 2 119627610 small insertion probably benign
RF046:Nusap1 UTSW 2 119627595 nonsense probably null
RF048:Nusap1 UTSW 2 119627599 small insertion probably benign
RF049:Nusap1 UTSW 2 119627583 small insertion probably benign
RF052:Nusap1 UTSW 2 119627584 small insertion probably benign
RF056:Nusap1 UTSW 2 119627581 small insertion probably benign
RF056:Nusap1 UTSW 2 119627586 small insertion probably benign
RF056:Nusap1 UTSW 2 119627591 small insertion probably benign
RF062:Nusap1 UTSW 2 119627601 small insertion probably benign
RF062:Nusap1 UTSW 2 119627610 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CGGACCATCCTGTGTTCATAC -3'
(R):5'- CACAGCATGTTTCCAGTCATC -3'

Sequencing Primer
(F):5'- GGACCATCCTGTGTTCATACTGTAAC -3'
(R):5'- TCCAGTCATCTAGCATCATGAAGG -3'
Posted On 2019-12-04