Incidental Mutation 'R7851:Olfr739'
ID606953
Institutional Source Beutler Lab
Gene Symbol Olfr739
Ensembl Gene ENSMUSG00000057903
Gene Nameolfactory receptor 739
SynonymsMOR106-2, GA_x6K02T2PMLR-6121675-6122604
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7851 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location50418626-50427888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50425370 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 284 (T284A)
Ref Sequence ENSEMBL: ENSMUSP00000150559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075261] [ENSMUST00000216949]
Predicted Effect probably damaging
Transcript: ENSMUST00000075261
AA Change: T284A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074740
Gene: ENSMUSG00000057903
AA Change: T284A

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 1.1e-53 PFAM
Pfam:7tm_1 43 292 1.9e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216949
AA Change: T284A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,410,012 probably null Het
Abcc3 A T 11: 94,359,660 L905* probably null Het
Adamts9 T G 6: 92,908,706 D401A probably damaging Het
Ankmy1 T C 1: 92,871,722 K918E probably damaging Het
Arfgef3 T C 10: 18,592,286 N1722S probably damaging Het
Arhgef18 A G 8: 3,448,409 I481V possibly damaging Het
Asxl3 T C 18: 22,517,222 I756T possibly damaging Het
Atp6v0b A G 4: 117,885,865 F49S probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Cd2ap A G 17: 42,824,472 probably null Het
Cnn3 T A 3: 121,457,343 Y304N possibly damaging Het
Cnot2 G A 10: 116,537,432 S22L possibly damaging Het
Coq6 A T 12: 84,372,155 H311L possibly damaging Het
Csf2rb2 T C 15: 78,288,937 N350S probably benign Het
Dhrs9 T A 2: 69,401,256 N253K probably benign Het
Dok7 T A 5: 35,056,936 M1K probably null Het
Eogt T A 6: 97,120,201 E313D probably benign Het
Etl4 T C 2: 20,744,140 S430P probably damaging Het
Gfod2 T A 8: 105,728,130 E39D probably benign Het
Gfral T C 9: 76,205,455 N65D probably benign Het
Gsdmc4 A T 15: 63,902,746 L62* probably null Het
Gyg T G 3: 20,122,747 M360L probably benign Het
Hsp90ab1 A T 17: 45,570,452 S255T probably benign Het
Hyal6 T A 6: 24,734,498 D143E probably benign Het
Ipp C T 4: 116,515,475 Q234* probably null Het
Ism1 A T 2: 139,757,265 D386V probably damaging Het
Jrkl T C 9: 13,244,349 T436A probably benign Het
Mup3 A C 4: 62,085,257 I125S possibly damaging Het
Myh6 T A 14: 54,953,051 E1003V possibly damaging Het
Neb T A 2: 52,153,064 I6785F probably benign Het
Olfr225 T C 11: 59,613,963 V333A probably benign Het
Olfr350 T A 2: 36,850,416 Y123* probably null Het
Olfr747 A G 14: 50,681,458 Y59H probably damaging Het
Olfr787 G T 10: 129,463,560 V295L probably benign Het
Pamr1 A T 2: 102,586,600 T86S probably benign Het
Pced1a A T 2: 130,422,316 M168K probably damaging Het
Pigs T C 11: 78,336,787 L259P probably damaging Het
Plch1 T C 3: 63,698,434 S1350G probably damaging Het
Prickle1 G A 15: 93,500,559 T796I possibly damaging Het
Ptcd3 T C 6: 71,902,859 I138M probably damaging Het
Ptprs T C 17: 56,425,482 E958G probably benign Het
Rcn3 A T 7: 45,086,812 D157E probably benign Het
Rft1 T C 14: 30,690,583 S534P probably benign Het
Ryr3 T C 2: 112,678,517 T3371A probably benign Het
Scn10a A T 9: 119,617,762 V1399D probably damaging Het
Sec61a1 T C 6: 88,512,165 T185A probably benign Het
Sgsm3 G A 15: 81,010,753 V607M probably damaging Het
Smurf2 T C 11: 106,830,926 Y581C probably damaging Het
Snx8 C A 5: 140,358,159 V101L probably damaging Het
Sp100 A T 1: 85,706,926 K180M probably benign Het
Spire2 T A 8: 123,356,699 probably null Het
St6galnac2 A G 11: 116,685,938 S86P probably benign Het
Sybu G A 15: 44,746,456 Q139* probably null Het
Tas2r114 T A 6: 131,689,925 I47F probably damaging Het
Tcf21 T C 10: 22,819,848 D19G probably benign Het
Terb2 T C 2: 122,186,313 F9L probably damaging Het
Tlr1 T C 5: 64,924,964 T757A possibly damaging Het
Tmco1 C T 1: 167,308,686 probably benign Het
Tshz3 T C 7: 36,771,589 F1001S probably damaging Het
Ttc25 C T 11: 100,545,829 T10I probably damaging Het
Vmn2r62 G A 7: 42,789,115 T99I probably benign Het
Wdr7 A T 18: 63,720,327 T33S probably benign Het
Other mutations in Olfr739
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Olfr739 APN 14 50424561 missense possibly damaging 0.88
IGL02430:Olfr739 APN 14 50425151 missense probably benign
IGL02603:Olfr739 APN 14 50425200 missense probably damaging 1.00
IGL02959:Olfr739 APN 14 50424932 missense possibly damaging 0.76
IGL03154:Olfr739 APN 14 50424623 missense probably benign 0.00
R0455:Olfr739 UTSW 14 50424902 missense possibly damaging 0.45
R1984:Olfr739 UTSW 14 50425391 missense possibly damaging 0.93
R3160:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R3161:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R3162:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R4821:Olfr739 UTSW 14 50424749 missense possibly damaging 0.96
R4880:Olfr739 UTSW 14 50425301 missense possibly damaging 0.90
R5047:Olfr739 UTSW 14 50425239 missense probably damaging 1.00
R5384:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5385:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5386:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5640:Olfr739 UTSW 14 50424654 missense probably benign 0.18
R5809:Olfr739 UTSW 14 50425448 makesense probably null
R6035:Olfr739 UTSW 14 50424527 missense probably benign
R6035:Olfr739 UTSW 14 50424527 missense probably benign
R6229:Olfr739 UTSW 14 50425205 missense probably benign 0.38
R6614:Olfr739 UTSW 14 50425089 missense probably benign 0.00
R7308:Olfr739 UTSW 14 50425265 missense possibly damaging 0.57
R7443:Olfr739 UTSW 14 50425050 missense probably damaging 1.00
R7699:Olfr739 UTSW 14 50425335 missense probably benign
R7700:Olfr739 UTSW 14 50425335 missense probably benign
R8397:Olfr739 UTSW 14 50424680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGTTCAGAGTTCCTTCA -3'
(R):5'- CTGACAACTATTGCCCTATTCATT -3'

Sequencing Primer
(F):5'- GTTCAGAGTTCCTTCAAGAGATGGAC -3'
(R):5'- GGGATGTCTACAGCTTCATCTGAAAG -3'
Posted On2019-12-20