Incidental Mutation 'R7851:Hyal6'
ID606927
Institutional Source Beutler Lab
Gene Symbol Hyal6
Ensembl Gene ENSMUSG00000029679
Gene Namehyaluronoglucosaminidase 6
Synonyms4932701A20Rik, Hyal-ps1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7851 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24733245-24745452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24734498 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 143 (D143E)
Ref Sequence ENSEMBL: ENSMUSP00000031690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031690]
Predicted Effect probably benign
Transcript: ENSMUST00000031690
AA Change: D143E

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031690
Gene: ENSMUSG00000029679
AA Change: D143E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 30 363 4.8e-136 PFAM
EGF 365 438 6.02e0 SMART
transmembrane domain 457 479 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (62/62)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T A 11: 101,410,012 probably null Het
Abcc3 A T 11: 94,359,660 L905* probably null Het
Adamts9 T G 6: 92,908,706 D401A probably damaging Het
Ankmy1 T C 1: 92,871,722 K918E probably damaging Het
Arfgef3 T C 10: 18,592,286 N1722S probably damaging Het
Arhgef18 A G 8: 3,448,409 I481V possibly damaging Het
Asxl3 T C 18: 22,517,222 I756T possibly damaging Het
Atp6v0b A G 4: 117,885,865 F49S probably damaging Het
Baz2b C A 2: 59,936,716 E107D probably damaging Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Cd2ap A G 17: 42,824,472 probably null Het
Cnn3 T A 3: 121,457,343 Y304N possibly damaging Het
Cnot2 G A 10: 116,537,432 S22L possibly damaging Het
Coq6 A T 12: 84,372,155 H311L possibly damaging Het
Csf2rb2 T C 15: 78,288,937 N350S probably benign Het
Dhrs9 T A 2: 69,401,256 N253K probably benign Het
Dok7 T A 5: 35,056,936 M1K probably null Het
Eogt T A 6: 97,120,201 E313D probably benign Het
Etl4 T C 2: 20,744,140 S430P probably damaging Het
Gfod2 T A 8: 105,728,130 E39D probably benign Het
Gfral T C 9: 76,205,455 N65D probably benign Het
Gsdmc4 A T 15: 63,902,746 L62* probably null Het
Gyg T G 3: 20,122,747 M360L probably benign Het
Hsp90ab1 A T 17: 45,570,452 S255T probably benign Het
Ipp C T 4: 116,515,475 Q234* probably null Het
Ism1 A T 2: 139,757,265 D386V probably damaging Het
Jrkl T C 9: 13,244,349 T436A probably benign Het
Mup3 A C 4: 62,085,257 I125S possibly damaging Het
Myh6 T A 14: 54,953,051 E1003V possibly damaging Het
Neb T A 2: 52,153,064 I6785F probably benign Het
Olfr225 T C 11: 59,613,963 V333A probably benign Het
Olfr350 T A 2: 36,850,416 Y123* probably null Het
Olfr739 A G 14: 50,425,370 T284A probably damaging Het
Olfr747 A G 14: 50,681,458 Y59H probably damaging Het
Olfr787 G T 10: 129,463,560 V295L probably benign Het
Pamr1 A T 2: 102,586,600 T86S probably benign Het
Pced1a A T 2: 130,422,316 M168K probably damaging Het
Pigs T C 11: 78,336,787 L259P probably damaging Het
Plch1 T C 3: 63,698,434 S1350G probably damaging Het
Prickle1 G A 15: 93,500,559 T796I possibly damaging Het
Ptcd3 T C 6: 71,902,859 I138M probably damaging Het
Ptprs T C 17: 56,425,482 E958G probably benign Het
Rcn3 A T 7: 45,086,812 D157E probably benign Het
Rft1 T C 14: 30,690,583 S534P probably benign Het
Ryr3 T C 2: 112,678,517 T3371A probably benign Het
Scn10a A T 9: 119,617,762 V1399D probably damaging Het
Sec61a1 T C 6: 88,512,165 T185A probably benign Het
Sgsm3 G A 15: 81,010,753 V607M probably damaging Het
Smurf2 T C 11: 106,830,926 Y581C probably damaging Het
Snx8 C A 5: 140,358,159 V101L probably damaging Het
Sp100 A T 1: 85,706,926 K180M probably benign Het
Spire2 T A 8: 123,356,699 probably null Het
St6galnac2 A G 11: 116,685,938 S86P probably benign Het
Sybu G A 15: 44,746,456 Q139* probably null Het
Tas2r114 T A 6: 131,689,925 I47F probably damaging Het
Tcf21 T C 10: 22,819,848 D19G probably benign Het
Terb2 T C 2: 122,186,313 F9L probably damaging Het
Tlr1 T C 5: 64,924,964 T757A possibly damaging Het
Tmco1 C T 1: 167,308,686 probably benign Het
Tshz3 T C 7: 36,771,589 F1001S probably damaging Het
Ttc25 C T 11: 100,545,829 T10I probably damaging Het
Vmn2r62 G A 7: 42,789,115 T99I probably benign Het
Wdr7 A T 18: 63,720,327 T33S probably benign Het
Other mutations in Hyal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Hyal6 APN 6 24734179 missense probably damaging 1.00
IGL02269:Hyal6 APN 6 24740859 missense probably damaging 0.97
IGL02729:Hyal6 APN 6 24734695 missense probably damaging 1.00
IGL02793:Hyal6 APN 6 24734379 nonsense probably null
IGL02943:Hyal6 APN 6 24743439 missense probably damaging 0.99
IGL03351:Hyal6 APN 6 24743429 missense probably damaging 1.00
R0481:Hyal6 UTSW 6 24743418 missense probably damaging 1.00
R0517:Hyal6 UTSW 6 24734853 missense probably benign
R0853:Hyal6 UTSW 6 24734073 missense probably benign
R1182:Hyal6 UTSW 6 24743417 missense probably damaging 1.00
R1401:Hyal6 UTSW 6 24743435 missense probably damaging 1.00
R1780:Hyal6 UTSW 6 24734032 splice site probably benign
R1858:Hyal6 UTSW 6 24740858 missense probably benign 0.01
R2011:Hyal6 UTSW 6 24734724 missense possibly damaging 0.69
R3441:Hyal6 UTSW 6 24734593 missense probably benign
R4819:Hyal6 UTSW 6 24734966 nonsense probably null
R5357:Hyal6 UTSW 6 24734518 missense probably benign 0.05
R5648:Hyal6 UTSW 6 24734236 missense possibly damaging 0.61
R5717:Hyal6 UTSW 6 24743691 missense probably benign 0.15
R5884:Hyal6 UTSW 6 24743369 missense probably damaging 1.00
R6657:Hyal6 UTSW 6 24734758 missense possibly damaging 0.61
R6826:Hyal6 UTSW 6 24734372 missense probably damaging 1.00
R7178:Hyal6 UTSW 6 24734835 missense probably benign 0.28
R7531:Hyal6 UTSW 6 24740787 missense possibly damaging 0.46
R7630:Hyal6 UTSW 6 24734584 missense probably damaging 1.00
R7787:Hyal6 UTSW 6 24743736 missense probably damaging 0.99
R8132:Hyal6 UTSW 6 24740828 missense possibly damaging 0.80
R8200:Hyal6 UTSW 6 24734566 missense probably benign 0.01
R8294:Hyal6 UTSW 6 24734379 missense possibly damaging 0.53
R8300:Hyal6 UTSW 6 24734088 missense probably benign
R8509:Hyal6 UTSW 6 24734606 missense probably damaging 1.00
R8705:Hyal6 UTSW 6 24734674 missense probably benign 0.01
R8917:Hyal6 UTSW 6 24734104 missense possibly damaging 0.96
X0019:Hyal6 UTSW 6 24734667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTTTCGAAACTCAGAGTGG -3'
(R):5'- GGTCTCATTTCTAAAGCCAACG -3'

Sequencing Primer
(F):5'- CCGTATTTTATCCAAAGGAACTCGGG -3'
(R):5'- CTCATTTCTAAAGCCAACGTGAGAG -3'
Posted On2019-12-20