Incidental Mutation 'R7903:Olfr1367'
ID610107
Institutional Source Beutler Lab
Gene Symbol Olfr1367
Ensembl Gene ENSMUSG00000045508
Gene Nameolfactory receptor 1367
SynonymsMOR256-16, MOR256-65, GA_x6K02T2QHY8-11899770-11898820
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7903 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21346910-21347964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21347876 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 316 (I316K)
Ref Sequence ENSEMBL: ENSMUSP00000055870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059216]
Predicted Effect probably benign
Transcript: ENSMUST00000059216
AA Change: I316K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055870
Gene: ENSMUSG00000045508
AA Change: I316K

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.6e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 153 9.3e-7 PFAM
Pfam:7tm_1 43 292 4.5e-25 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,475,726 probably null Het
Acsm2 A T 7: 119,595,992 T596S probably benign Het
Aggf1 T C 13: 95,356,458 K548E probably damaging Het
Anapc15 T G 7: 101,897,986 V23G probably benign Het
Atp10a T C 7: 58,658,822 L123P probably damaging Het
Brf2 G A 8: 27,126,093 T88M possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Ccdc14 A T 16: 34,704,910 H191L probably damaging Het
Cdc42bpg T A 19: 6,313,469 V453E possibly damaging Het
Corin T C 5: 72,301,500 K1110E probably benign Het
Cubn T C 2: 13,468,869 D421G probably damaging Het
D130043K22Rik T G 13: 24,876,012 V622G probably damaging Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Dnah3 A G 7: 120,042,128 S1190P probably damaging Het
Elavl1 T C 8: 4,301,756 K120R probably benign Het
Epb41l3 T A 17: 69,274,337 probably null Het
Fubp1 G A 3: 152,214,861 W79* probably null Het
Gm1673 T A 5: 33,983,566 probably null Het
Gm4869 T C 5: 140,476,012 V523A probably damaging Het
Gm5580 A G 6: 116,551,251 T30A probably benign Het
Gsto2 T A 19: 47,884,657 I157N possibly damaging Het
Gucy2d A G 7: 98,459,065 D735G probably damaging Het
H2-D1 A T 17: 35,263,991 I166F probably damaging Het
Hars2 C A 18: 36,786,192 R128S probably damaging Het
Igf1r T C 7: 68,184,752 F496S probably damaging Het
Inf2 T C 12: 112,612,554 V1256A unknown Het
Krt34 A T 11: 100,041,495 M1K probably null Het
Lamtor2 T C 3: 88,552,510 N26D possibly damaging Het
Map3k10 T C 7: 27,657,957 T799A probably damaging Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcm10 T C 2: 4,995,802 T693A probably benign Het
Mgarp G T 3: 51,396,698 A10E Het
Mns1 A T 9: 72,452,811 E414D probably benign Het
Myo16 A G 8: 10,376,265 S341G probably null Het
Nags A T 11: 102,146,677 D198V possibly damaging Het
Nedd4l C T 18: 65,186,367 P464S probably damaging Het
Nsfl1c T C 2: 151,496,602 Y42H probably damaging Het
Obscn T C 11: 59,079,116 M67V probably benign Het
Pcsk5 A T 19: 17,572,483 L715Q probably damaging Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pfkfb4 A T 9: 108,998,951 N64Y probably damaging Het
Pidd1 A G 7: 141,439,831 F673L probably damaging Het
Pla2g7 A G 17: 43,600,621 probably null Het
Pml T C 9: 58,249,584 E36G probably benign Het
Proser1 C A 3: 53,479,082 S795* probably null Het
Ptprs T A 17: 56,424,960 K1016* probably null Het
Rbfox1 T A 16: 7,224,511 S76R probably benign Het
Reck A T 4: 43,927,166 I486F possibly damaging Het
Rnf103 A T 6: 71,509,154 K256N probably damaging Het
Setd2 A T 9: 110,617,837 N713I Het
Slc38a4 C T 15: 97,008,928 G310S probably benign Het
Slc7a4 C T 16: 17,575,281 R218H probably benign Het
Slc7a7 T C 14: 54,373,909 H344R probably damaging Het
Smarcc1 G A 9: 110,204,266 E810K probably benign Het
Sord T A 2: 122,263,225 M275K probably benign Het
Spire2 C A 8: 123,368,750 P631T probably benign Het
Sult6b1 T C 17: 78,890,850 K207R probably benign Het
Syde2 T A 3: 145,998,788 D498E probably damaging Het
Syne2 C T 12: 76,064,184 T1024M probably damaging Het
Tdrd9 T A 12: 112,051,976 D1276E possibly damaging Het
Tm7sf2 A G 19: 6,071,335 F219S probably damaging Het
Tmcc2 C T 1: 132,360,461 G496D probably benign Het
Tmtc4 G A 14: 122,927,648 H600Y probably benign Het
Vmn1r224 A T 17: 20,420,047 L295F probably benign Het
Vmn1r91 T C 7: 20,101,210 I18T possibly damaging Het
Vwa7 G A 17: 35,017,787 R110H probably damaging Het
Wbp2nl C T 15: 82,306,131 Q87* probably null Het
Other mutations in Olfr1367
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1367 APN 13 21347015 missense probably damaging 0.99
IGL01327:Olfr1367 APN 13 21347207 missense probably benign 0.00
IGL02624:Olfr1367 APN 13 21347512 missense probably benign 0.11
IGL02718:Olfr1367 APN 13 21347384 missense probably damaging 1.00
IGL02744:Olfr1367 APN 13 21346994 missense probably damaging 0.99
IGL03354:Olfr1367 APN 13 21347516 missense possibly damaging 0.65
R1433:Olfr1367 UTSW 13 21347024 missense probably benign 0.00
R1567:Olfr1367 UTSW 13 21347425 missense probably benign 0.00
R1857:Olfr1367 UTSW 13 21347176 missense possibly damaging 0.63
R1858:Olfr1367 UTSW 13 21347176 missense possibly damaging 0.63
R1927:Olfr1367 UTSW 13 21346946 missense probably benign 0.04
R4627:Olfr1367 UTSW 13 21347464 missense probably damaging 1.00
R6146:Olfr1367 UTSW 13 21346994 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TACATCTACATGCAACCCTCAGA -3'
(R):5'- CACTGACTGGACTGTGGTATCTG -3'

Sequencing Primer
(F):5'- GAGGATGGCTCCCAAGACCTTATC -3'
(R):5'- GTCTAGGACCTTCTAACAGTGAAGC -3'
Posted On2019-12-20