Incidental Mutation 'R0675:Olfr92'
ID61635
Institutional Source Beutler Lab
Gene Symbol Olfr92
Ensembl Gene ENSMUSG00000096477
Gene Nameolfactory receptor 92
SynonymsMOR256-29, GA_x6K02T2PSCP-1552066-1551128
MMRRC Submission 038860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R0675 (G1)
Quality Score164
Status Validated
Chromosome17
Chromosomal Location37110512-37120088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 37111455 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 176 (L176V)
Ref Sequence ENSEMBL: ENSMUSP00000150988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168659] [ENSMUST00000214994] [ENSMUST00000216341]
Predicted Effect probably benign
Transcript: ENSMUST00000168659
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128393
Gene: ENSMUSG00000096477
AA Change: L176V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 304 5.1e-7 PFAM
Pfam:7tm_4 29 306 3.4e-50 PFAM
Pfam:7tm_1 39 288 1.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174626
Predicted Effect probably benign
Transcript: ENSMUST00000214994
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216341
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (88/91)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001C19Rik T C 17: 47,413,776 E140G probably benign Het
4932431P20Rik T C 7: 29,532,517 noncoding transcript Het
Ablim2 C T 5: 35,866,780 probably benign Het
Aire T C 10: 78,034,493 probably benign Het
Akap12 T C 10: 4,353,315 S42P probably benign Het
Amigo1 T C 3: 108,191,669 probably benign Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Ank1 T A 8: 23,110,384 probably benign Het
Ano5 A T 7: 51,574,810 T472S probably damaging Het
Arid3c T C 4: 41,725,958 D215G probably damaging Het
Cd200 T C 16: 45,397,110 I73V probably benign Het
Cd47 T C 16: 49,906,799 I318T possibly damaging Het
Cep290 A G 10: 100,568,813 probably null Het
Cep350 A G 1: 155,959,753 S66P possibly damaging Het
Cfap46 C T 7: 139,676,034 C300Y probably damaging Het
Chd1 T A 17: 15,758,261 probably benign Het
Chd5 C A 4: 152,385,950 T1913K probably benign Het
Clec4b1 A G 6: 123,071,446 Y180C probably damaging Het
Cntnap5c A T 17: 58,034,995 D227V probably damaging Het
Col19a1 C G 1: 24,575,455 probably benign Het
Csmd1 A T 8: 16,158,131 M1270K probably benign Het
Cyp2c66 T A 19: 39,186,616 F487I possibly damaging Het
Dpp8 T C 9: 65,066,502 probably benign Het
Duoxa1 A T 2: 122,306,380 probably benign Het
Edil3 A G 13: 89,177,280 K263E probably damaging Het
Fat2 A G 11: 55,309,209 L1013P probably damaging Het
Fras1 T C 5: 96,667,387 probably benign Het
Gab1 A G 8: 80,769,668 S668P probably damaging Het
Galnt14 T C 17: 73,545,035 T130A probably damaging Het
Gm10192 G A 4: 97,182,872 H99Y unknown Het
Gm5592 A G 7: 41,289,387 T698A possibly damaging Het
Gm6605 C A 7: 38,448,275 noncoding transcript Het
Gsdma3 A G 11: 98,631,191 K149R probably benign Het
Igkv4-71 A G 6: 69,243,427 S29P probably damaging Het
Igsf10 C T 3: 59,328,594 V1389I probably benign Het
Ik T C 18: 36,747,333 probably benign Het
Ino80 G A 2: 119,383,481 P1203S probably damaging Het
Iqsec2 G A X: 152,204,124 E398K possibly damaging Het
Jmjd6 A G 11: 116,840,527 V232A probably damaging Het
Klhdc9 G A 1: 171,360,327 T112M possibly damaging Het
Marcks A G 10: 37,141,185 probably benign Het
Mctp2 T A 7: 72,083,170 T829S probably damaging Het
Mroh2a C A 1: 88,228,380 A78E probably damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Mtmr14 A T 6: 113,270,647 H518L probably damaging Het
Mum1 T A 10: 80,230,080 V56E probably damaging Het
Myo5c T C 9: 75,278,289 M978T probably benign Het
Nlrc3 T C 16: 3,948,911 I1015V probably benign Het
Nlrp5 C A 7: 23,417,417 Q189K possibly damaging Het
Olfr1082 T C 2: 86,594,079 I250V probably benign Het
Olfr385 A C 11: 73,589,252 L162R probably damaging Het
Olfr583 A G 7: 103,051,702 I135V probably benign Het
Otof T A 5: 30,382,361 Y1051F probably benign Het
Pcdhb14 C A 18: 37,448,339 T166K possibly damaging Het
Pla2g4e A G 2: 120,200,198 probably benign Het
Polr3gl T C 3: 96,582,155 E20G probably damaging Het
Psmd1 A G 1: 86,082,039 D295G probably benign Het
Ptpn21 C A 12: 98,688,216 A831S probably benign Het
Rd3l T C 12: 111,980,162 D60G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,441,834 D2624G probably benign Het
Sec31a T C 5: 100,393,207 D347G probably damaging Het
Sema4g G A 19: 44,997,587 R289H probably damaging Het
Sema5b C T 16: 35,660,333 T761I probably benign Het
Sept1 A T 7: 127,216,999 F86L probably damaging Het
Shank3 T C 15: 89,531,388 V627A possibly damaging Het
Slc25a46 C A 18: 31,609,588 G75V probably benign Het
Slc45a2 T A 15: 11,025,778 Y405N probably damaging Het
Spidr T C 16: 16,037,634 E339G probably damaging Het
Sptbn1 A T 11: 30,117,903 H1770Q probably damaging Het
Srgap1 T C 10: 121,792,235 Y944C probably damaging Het
Supt20 C T 3: 54,706,969 T169I probably damaging Het
Tie1 G A 4: 118,479,769 Q587* probably null Het
Tmem214 A G 5: 30,871,825 T203A possibly damaging Het
Tmprss15 C A 16: 78,985,950 S742I probably damaging Het
Zfhx2 A G 14: 55,063,163 V2377A probably damaging Het
Zfp763 G A 17: 33,019,800 H124Y possibly damaging Het
Zfp846 T C 9: 20,593,557 S238P probably benign Het
Other mutations in Olfr92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr92 APN 17 37111809 missense probably damaging 1.00
IGL02850:Olfr92 APN 17 37111973 missense probably benign 0.35
IGL03209:Olfr92 APN 17 37111521 missense probably benign 0.04
R0579:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0580:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0582:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0615:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0669:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0674:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R2424:Olfr92 UTSW 17 37111516 missense probably benign 0.02
R3714:Olfr92 UTSW 17 37111335 missense probably damaging 1.00
R4393:Olfr92 UTSW 17 37114084 intron probably benign
R5811:Olfr92 UTSW 17 37111757 missense probably benign 0.00
R6615:Olfr92 UTSW 17 37111602 missense probably damaging 1.00
R6853:Olfr92 UTSW 17 37111508 missense probably benign 0.02
R6876:Olfr92 UTSW 17 37111206 missense probably damaging 1.00
R7665:Olfr92 UTSW 17 37111391 missense probably benign 0.20
R8087:Olfr92 UTSW 17 37111548 missense probably benign
Z1177:Olfr92 UTSW 17 37111430 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGAGCTTATCTTCAGCACTGCC -3'
(R):5'- GAAACACACTCATCCTCCTGCTGTC -3'

Sequencing Primer
(F):5'- CCTGGCAATGGCACCATAAG -3'
(R):5'- TCATGTCCCTGGGTACAACAG -3'
Posted On2013-07-30