Incidental Mutation 'R0582:Olfr92'
ID56488
Institutional Source Beutler Lab
Gene Symbol Olfr92
Ensembl Gene ENSMUSG00000096477
Gene Nameolfactory receptor 92
SynonymsMOR256-29, GA_x6K02T2PSCP-1552066-1551128
MMRRC Submission 038772-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0582 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37110512-37120088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 37111455 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 176 (L176V)
Ref Sequence ENSEMBL: ENSMUSP00000150988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168659] [ENSMUST00000214994] [ENSMUST00000216341]
Predicted Effect probably benign
Transcript: ENSMUST00000168659
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128393
Gene: ENSMUSG00000096477
AA Change: L176V

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 23 304 5.1e-7 PFAM
Pfam:7tm_4 29 306 3.4e-50 PFAM
Pfam:7tm_1 39 288 1.1e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174626
Predicted Effect probably benign
Transcript: ENSMUST00000214994
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216341
AA Change: L176V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency 100% (45/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,125,082 noncoding transcript Het
Abcb5 A T 12: 118,940,412 M186K probably benign Het
Afm T C 5: 90,524,780 probably benign Het
Arfgef3 G A 10: 18,611,290 A1332V probably damaging Het
Atp11a T C 8: 12,831,214 S451P probably benign Het
Birc6 T A 17: 74,643,337 V3189E probably damaging Het
Ccdc150 C T 1: 54,329,511 A626V probably benign Het
Ccdc50 G A 16: 27,444,659 probably benign Het
Cntln T C 4: 84,884,741 S93P probably damaging Het
Ctnna2 C A 6: 77,758,417 V106L probably benign Het
Ctnnal1 G C 4: 56,813,228 Q668E probably damaging Het
Cyp1a2 G A 9: 57,680,246 probably benign Het
Dnah8 A G 17: 30,718,961 D1604G probably benign Het
Dscaml1 A T 9: 45,668,264 I370F possibly damaging Het
Ears2 T C 7: 122,055,658 E129G probably benign Het
Gm4981 A T 10: 58,235,686 S235R probably benign Het
Igsf10 T C 3: 59,319,767 I2162V probably benign Het
Ints9 C T 14: 64,980,149 P42S probably damaging Het
Ipp T C 4: 116,515,467 L231S probably damaging Het
Lyn T A 4: 3,743,296 L72Q probably damaging Het
Nfe2l2 T A 2: 75,676,768 E329D probably damaging Het
Olfr628 G A 7: 103,732,673 C249Y possibly damaging Het
Pdyn A C 2: 129,689,738 L44R probably damaging Het
Pkd1l1 A G 11: 8,931,699 probably benign Het
Prpf40a A T 2: 53,145,692 F695L probably damaging Het
Rnf217 A G 10: 31,608,767 Y140H possibly damaging Het
Sema6c C T 3: 95,169,197 R265C probably damaging Het
Slc7a8 C A 14: 54,758,444 C167F probably damaging Het
Snap47 A T 11: 59,428,433 L293* probably null Het
Snx3 A T 10: 42,533,280 probably benign Het
Sycp2l T A 13: 41,137,955 probably benign Het
Taar3 A G 10: 23,949,817 Y87C probably damaging Het
Tm4sf4 T C 3: 57,433,857 probably benign Het
Tssc4 T C 7: 143,070,509 S185P probably damaging Het
Ttc28 G T 5: 111,183,296 A430S probably damaging Het
Vmn2r27 T C 6: 124,224,290 D236G probably benign Het
Vps54 G T 11: 21,300,137 D508Y probably damaging Het
Wdr53 G A 16: 32,251,908 V24M probably damaging Het
Xirp2 T G 2: 67,508,866 L484V probably benign Het
Zfyve26 T C 12: 79,246,222 D2051G probably damaging Het
Other mutations in Olfr92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Olfr92 APN 17 37111809 missense probably damaging 1.00
IGL02850:Olfr92 APN 17 37111973 missense probably benign 0.35
IGL03209:Olfr92 APN 17 37111521 missense probably benign 0.04
R0579:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0580:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0615:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0669:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0674:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R0675:Olfr92 UTSW 17 37111455 missense probably benign 0.00
R2424:Olfr92 UTSW 17 37111516 missense probably benign 0.02
R3714:Olfr92 UTSW 17 37111335 missense probably damaging 1.00
R4393:Olfr92 UTSW 17 37114084 intron probably benign
R5811:Olfr92 UTSW 17 37111757 missense probably benign 0.00
R6615:Olfr92 UTSW 17 37111602 missense probably damaging 1.00
R6853:Olfr92 UTSW 17 37111508 missense probably benign 0.02
R6876:Olfr92 UTSW 17 37111206 missense probably damaging 1.00
R7665:Olfr92 UTSW 17 37111391 missense probably benign 0.20
R8087:Olfr92 UTSW 17 37111548 missense probably benign
Z1177:Olfr92 UTSW 17 37111430 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CAGAGCTTATCTTCAGCACTGCCC -3'
(R):5'- GAAACACACTCATCCTCCTGCTGTC -3'

Sequencing Primer
(F):5'- CCTGGCAATGGCACCATAAG -3'
(R):5'- TCATGTCCCTGGGTACAACAG -3'
Posted On2013-07-11