Incidental Mutation 'R0679:Utp15'
ID61728
Institutional Source Beutler Lab
Gene Symbol Utp15
Ensembl Gene ENSMUSG00000041747
Gene NameUTP15 small subunit processome component
Synonyms
MMRRC Submission 038864-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0679 (G1)
Quality Score95
Status Not validated
Chromosome13
Chromosomal Location98246845-98263041 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98259403 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 52 (Y52N)
Ref Sequence ENSEMBL: ENSMUSP00000048204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022164] [ENSMUST00000040972] [ENSMUST00000091356] [ENSMUST00000123924] [ENSMUST00000150352] [ENSMUST00000150916] [ENSMUST00000226100]
Predicted Effect probably benign
Transcript: ENSMUST00000022164
SMART Domains Protein: ENSMUSP00000022164
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Blast:ANK 279 308 1e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000040972
AA Change: Y52N

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048204
Gene: ENSMUSG00000041747
AA Change: Y52N

DomainStartEndE-ValueType
WD40 31 66 6.85e1 SMART
WD40 69 108 1.66e-5 SMART
WD40 111 150 2.82e-8 SMART
WD40 153 193 7.33e-7 SMART
WD40 196 233 3.9e-2 SMART
WD40 237 276 1.39e-7 SMART
WD40 279 317 1.7e2 SMART
Pfam:UTP15_C 343 490 3.5e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091356
SMART Domains Protein: ENSMUSP00000088915
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123924
SMART Domains Protein: ENSMUSP00000122701
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150352
SMART Domains Protein: ENSMUSP00000117508
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 180 209 1.45e-6 SMART
ANK 213 242 1.05e-3 SMART
ANK 246 275 1.76e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150916
SMART Domains Protein: ENSMUSP00000116590
Gene: ENSMUSG00000021661

DomainStartEndE-ValueType
ANK 20 49 1.45e-6 SMART
ANK 53 82 1.05e-3 SMART
ANK 86 115 1.76e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224842
Predicted Effect probably benign
Transcript: ENSMUST00000226100
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,223,122 V1943L probably benign Het
Adgrl3 G A 5: 81,794,977 D1507N probably damaging Het
Cry2 A G 2: 92,413,715 I371T probably damaging Het
L3mbtl3 T A 10: 26,313,933 K478* probably null Het
Olfr196 G A 16: 59,167,616 H176Y probably damaging Het
Plcg1 C T 2: 160,756,910 P842S probably damaging Het
Ros1 T C 10: 52,066,295 R2111G possibly damaging Het
Sox10 A G 15: 79,156,588 S90P probably benign Het
Tbc1d32 A C 10: 56,180,576 Y423D probably damaging Het
Vps13b T G 15: 35,709,703 I1932S possibly damaging Het
Zfp457 A T 13: 67,293,591 C211S probably damaging Het
Other mutations in Utp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02951:Utp15 APN 13 98257952 missense probably damaging 1.00
IGL02960:Utp15 APN 13 98252881 missense probably benign 0.30
IGL03271:Utp15 APN 13 98253694 missense probably damaging 1.00
R0125:Utp15 UTSW 13 98250882 missense possibly damaging 0.81
R1447:Utp15 UTSW 13 98252878 missense possibly damaging 0.68
R1618:Utp15 UTSW 13 98257187 missense probably benign 0.16
R1992:Utp15 UTSW 13 98250912 missense probably benign
R2110:Utp15 UTSW 13 98254985 missense probably damaging 1.00
R2263:Utp15 UTSW 13 98257925 missense probably benign 0.03
R3888:Utp15 UTSW 13 98259166 missense probably benign 0.00
R4355:Utp15 UTSW 13 98259247 missense possibly damaging 0.48
R5436:Utp15 UTSW 13 98260846 unclassified probably null
R5568:Utp15 UTSW 13 98257925 missense probably benign 0.03
R6489:Utp15 UTSW 13 98250609 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCTTCACTGCCAGCAACGAGC -3'
(R):5'- ATTGTCAGCAGGGATCGTCTAGGG -3'

Sequencing Primer
(F):5'- AGTCGCACAATATGCTGTGTC -3'
(R):5'- CATCAGGCTGAGTTTTGCTTC -3'
Posted On2013-07-30