Incidental Mutation 'R8051:Fnbp4'
ID619038
Institutional Source Beutler Lab
Gene Symbol Fnbp4
Ensembl Gene ENSMUSG00000008200
Gene Nameformin binding protein 4
SynonymsFBP30
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.909) question?
Stock #R8051 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location90745370-90781021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90777739 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 935 (V935A)
Ref Sequence ENSEMBL: ENSMUSP00000013759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013759] [ENSMUST00000051831] [ENSMUST00000136058] [ENSMUST00000170320]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013759
AA Change: V935A

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000013759
Gene: ENSMUSG00000008200
AA Change: V935A

DomainStartEndE-ValueType
low complexity region 65 140 N/A INTRINSIC
low complexity region 165 175 N/A INTRINSIC
low complexity region 204 235 N/A INTRINSIC
WW 265 298 3.58e-5 SMART
low complexity region 372 381 N/A INTRINSIC
low complexity region 386 393 N/A INTRINSIC
low complexity region 404 416 N/A INTRINSIC
coiled coil region 442 478 N/A INTRINSIC
low complexity region 515 533 N/A INTRINSIC
WW 650 683 1.77e-9 SMART
low complexity region 757 788 N/A INTRINSIC
low complexity region 891 909 N/A INTRINSIC
low complexity region 955 1002 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051831
SMART Domains Protein: ENSMUSP00000051620
Gene: ENSMUSG00000040812

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 565 1.6e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136058
SMART Domains Protein: ENSMUSP00000115632
Gene: ENSMUSG00000040812

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 374 618 2.8e-32 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170320
SMART Domains Protein: ENSMUSP00000129216
Gene: ENSMUSG00000040812

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
Pfam:Peptidase_M14 376 558 1.8e-18 PFAM
low complexity region 640 655 N/A INTRINSIC
low complexity region 674 689 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,273,412 probably benign Het
Acan T A 7: 79,100,779 L1766Q probably damaging Het
Adgrl3 A G 5: 81,465,266 Y114C probably damaging Het
Ano9 T A 7: 141,104,532 I472F probably damaging Het
Arhgap10 A G 8: 77,517,680 F35S probably damaging Het
Btnl2 T A 17: 34,363,499 D346E probably damaging Het
C4bp A T 1: 130,655,968 C88S probably damaging Het
Cavin2 A T 1: 51,301,124 Q320L probably benign Het
Chtf18 C A 17: 25,723,479 V462L probably benign Het
Crisp3 A T 17: 40,232,560 S134R probably benign Het
Dlg4 C A 11: 70,031,642 probably benign Het
Dsc3 A T 18: 19,981,213 M328K probably damaging Het
Efemp2 T A 19: 5,476,067 D73E probably damaging Het
Fbn1 C T 2: 125,306,463 A2622T possibly damaging Het
Flt1 T C 5: 147,582,691 H938R probably benign Het
Flt3 T G 5: 147,358,955 probably benign Het
Frem2 T C 3: 53,535,355 N2587S probably benign Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gm36864 A T 7: 44,242,552 I385F probably benign Het
Il17re G T 6: 113,459,367 R47L probably benign Het
Il27ra A G 8: 84,033,949 probably null Het
Irf4 A G 13: 30,761,473 I401V probably damaging Het
Kat6a T C 8: 22,910,249 L342S probably damaging Het
Klc1 T A 12: 111,781,950 C390S possibly damaging Het
Klhl22 A T 16: 17,792,579 I565F probably damaging Het
Krt26 A T 11: 99,337,846 L20Q probably damaging Het
Lamb3 T C 1: 193,330,067 V384A possibly damaging Het
Lmo2 T A 2: 103,970,700 L80Q possibly damaging Het
Lrrc37a T G 11: 103,503,126 E491A possibly damaging Het
Ninj1 T A 13: 49,193,812 M51K probably damaging Het
Olfr109 G A 17: 37,466,322 G39R probably damaging Het
Olfr742 C A 14: 50,515,643 N146K probably benign Het
Plppr3 T A 10: 79,867,004 T142S probably damaging Het
Rab2b T C 14: 52,268,696 D103G probably damaging Het
Rap1gap2 G T 11: 74,395,825 R550S probably damaging Het
Rbm33 A G 5: 28,352,625 N279D probably damaging Het
Rhox9 C T X: 37,901,376 G40R probably benign Het
Selplg G A 5: 113,819,441 T268I probably damaging Het
Slc20a1 T C 2: 129,208,200 M426T possibly damaging Het
Spata18 A T 5: 73,669,720 Y220F Het
Spns1 T C 7: 126,372,536 T281A probably benign Het
Sptan1 C T 2: 30,030,159 R2288C probably damaging Het
Tacstd2 T C 6: 67,535,399 D103G probably damaging Het
Tmem121 C T 12: 113,188,867 A235V probably benign Het
Try4 A G 6: 41,305,062 D194G probably damaging Het
Tyrp1 C A 4: 80,837,660 T222K probably damaging Het
Zfp57 T A 17: 37,009,893 V213D probably damaging Het
Zfy2 A T Y: 2,117,380 probably benign Het
Zkscan4 G A 13: 21,484,653 G454R not run Het
Other mutations in Fnbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Fnbp4 APN 2 90751622 splice site probably benign
IGL00731:Fnbp4 APN 2 90768643 missense probably benign
IGL01021:Fnbp4 APN 2 90777669 missense probably benign 0.06
IGL01097:Fnbp4 APN 2 90776350 missense possibly damaging 0.63
IGL02504:Fnbp4 APN 2 90768543 missense probably damaging 1.00
IGL02510:Fnbp4 APN 2 90751475 missense probably benign
IGL02673:Fnbp4 APN 2 90763472 missense probably benign 0.01
IGL03024:Fnbp4 APN 2 90751179 missense probably benign 0.11
IGL03221:Fnbp4 APN 2 90777718 missense possibly damaging 0.65
R0570:Fnbp4 UTSW 2 90752957 missense probably damaging 1.00
R1914:Fnbp4 UTSW 2 90779193 unclassified probably benign
R1925:Fnbp4 UTSW 2 90765843 missense probably damaging 1.00
R2051:Fnbp4 UTSW 2 90757532 missense probably benign 0.05
R2069:Fnbp4 UTSW 2 90758372 missense probably damaging 1.00
R2165:Fnbp4 UTSW 2 90767399 splice site probably null
R2262:Fnbp4 UTSW 2 90757404 missense probably damaging 1.00
R3836:Fnbp4 UTSW 2 90746785 missense probably damaging 1.00
R4077:Fnbp4 UTSW 2 90758477 nonsense probably null
R4356:Fnbp4 UTSW 2 90758339 missense probably damaging 1.00
R4401:Fnbp4 UTSW 2 90746758 missense possibly damaging 0.62
R4491:Fnbp4 UTSW 2 90752968 critical splice donor site probably null
R4914:Fnbp4 UTSW 2 90751169 missense probably benign 0.00
R4981:Fnbp4 UTSW 2 90765830 missense probably damaging 1.00
R5165:Fnbp4 UTSW 2 90777657 missense possibly damaging 0.65
R5272:Fnbp4 UTSW 2 90753115 missense probably benign
R5683:Fnbp4 UTSW 2 90752862 missense probably damaging 1.00
R5860:Fnbp4 UTSW 2 90757482 missense probably benign 0.00
R5905:Fnbp4 UTSW 2 90751134 missense probably benign 0.29
R5914:Fnbp4 UTSW 2 90774793 intron probably benign
R6028:Fnbp4 UTSW 2 90751134 missense probably benign 0.29
R6270:Fnbp4 UTSW 2 90757463 missense probably damaging 1.00
R6379:Fnbp4 UTSW 2 90751124 missense probably benign 0.41
R6389:Fnbp4 UTSW 2 90745535 missense unknown
R6883:Fnbp4 UTSW 2 90745828 critical splice donor site probably null
R6940:Fnbp4 UTSW 2 90745514 missense unknown
R7242:Fnbp4 UTSW 2 90745796 missense unknown
R7393:Fnbp4 UTSW 2 90779316 missense probably damaging 0.99
R7454:Fnbp4 UTSW 2 90777815 unclassified probably benign
R7455:Fnbp4 UTSW 2 90777815 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGTTAGGTCACCAAGCTGTTG -3'
(R):5'- TGCTATGTGAGTACCATCACC -3'

Sequencing Primer
(F):5'- CAAGCTGTTGGGATGGCAC -3'
(R):5'- GCTATGTGAGTACCATCACCTTAAAC -3'
Posted On2020-01-23