Incidental Mutation 'R0665:Ralgds'
ID61969
Institutional Source Beutler Lab
Gene Symbol Ralgds
Ensembl Gene ENSMUSG00000026821
Gene Nameral guanine nucleotide dissociation stimulator
SynonymsRalGDS, Gnds, Rgds
MMRRC Submission 038850-MU
Accession Numbers

Ncbi RefSeq: NM_001145835.1, NM_001145836.1, NM_009058.2, NM_001145834.1; MGI:107485

Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0665 (G1)
Quality Score95
Status Not validated
Chromosome2
Chromosomal Location28513125-28553081 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28545206 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 458 (H458R)
Ref Sequence ENSEMBL: ENSMUSP00000097812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028170] [ENSMUST00000100241] [ENSMUST00000113893] [ENSMUST00000135803] [ENSMUST00000140704]
Predicted Effect probably benign
Transcript: ENSMUST00000028170
AA Change: H403R

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028170
Gene: ENSMUSG00000026821
AA Change: H403R

DomainStartEndE-ValueType
RasGEFN 56 194 4.02e-37 SMART
low complexity region 239 285 N/A INTRINSIC
RasGEF 320 587 5.28e-118 SMART
low complexity region 613 626 N/A INTRINSIC
low complexity region 646 655 N/A INTRINSIC
low complexity region 683 712 N/A INTRINSIC
low complexity region 716 726 N/A INTRINSIC
RA 736 823 6.51e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100241
AA Change: H458R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097812
Gene: ENSMUSG00000026821
AA Change: H458R

DomainStartEndE-ValueType
RasGEFN 111 249 4.02e-37 SMART
low complexity region 294 340 N/A INTRINSIC
RasGEF 375 642 5.28e-118 SMART
low complexity region 668 681 N/A INTRINSIC
low complexity region 701 710 N/A INTRINSIC
low complexity region 738 767 N/A INTRINSIC
low complexity region 771 781 N/A INTRINSIC
RA 791 878 6.51e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113893
AA Change: H446R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000109526
Gene: ENSMUSG00000026821
AA Change: H446R

DomainStartEndE-ValueType
RasGEFN 111 237 1.25e-42 SMART
low complexity region 282 328 N/A INTRINSIC
RasGEF 363 630 5.28e-118 SMART
low complexity region 656 669 N/A INTRINSIC
low complexity region 689 698 N/A INTRINSIC
low complexity region 726 755 N/A INTRINSIC
low complexity region 759 769 N/A INTRINSIC
RA 779 866 6.51e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130281
Predicted Effect probably benign
Transcript: ENSMUST00000135803
SMART Domains Protein: ENSMUSP00000115092
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 56 127 2.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137215
SMART Domains Protein: ENSMUSP00000116215
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
RasGEFN 1 107 5.55e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137513
Predicted Effect probably benign
Transcript: ENSMUST00000140704
SMART Domains Protein: ENSMUSP00000118966
Gene: ENSMUSG00000026821

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
RA 36 123 6.51e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146217
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 3574574
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanine nucleotide dissociation stimulators (GDSs, or exchange factors), such as RALGDS, are effectors of Ras-related GTPases (see MIM 190020) that participate in signaling for a variety of cellular processes.[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous mutant mice exhibit reduced tumor incidence, size and progression to malignancy in multistage skin carcinogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(5) Gene trapped(11)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl2 A G 2: 90,801,210 Y304C probably damaging Het
B3galt2 T C 1: 143,646,453 V109A possibly damaging Het
Chml T A 1: 175,687,895 E153D probably benign Het
Dap3 A T 3: 88,930,997 C78* probably null Het
Dnah8 T C 17: 30,736,155 F2053L probably damaging Het
Dppa3 A G 6: 122,629,980 E143G probably damaging Het
Espnl T G 1: 91,334,687 probably null Het
Fat3 C T 9: 15,997,402 A2435T probably benign Het
Flnc G A 6: 29,455,531 V2027M probably damaging Het
Gtf2h2 C T 13: 100,481,054 G200E probably damaging Het
Gtpbp1 A G 15: 79,713,447 I348V probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnk10 T C 12: 98,440,685 I251V probably benign Het
Kri1 G A 9: 21,281,640 probably benign Het
Lcmt1 G A 7: 123,402,871 D120N probably damaging Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Olfr1112 A G 2: 87,192,308 Y207C probably damaging Het
Olfr1136 C T 2: 87,693,808 V25I probably benign Het
Olfr350 T C 2: 36,850,190 L48P probably damaging Het
Phyhd1 A G 2: 30,281,028 H241R probably damaging Het
Ppp2r5d A T 17: 46,686,404 N287K probably damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Sdhc T C 1: 171,136,057 Y80C probably damaging Het
Smarca4 CGAGGAGGAGGAGGAGG CGAGGAGGAGGAGG 9: 21,700,943 probably benign Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Triobp T C 15: 78,973,898 L1233P possibly damaging Het
Trpc6 A C 9: 8,634,122 T401P probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Other mutations in Ralgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Ralgds APN 2 28552218 missense probably damaging 1.00
IGL01774:Ralgds APN 2 28550542 nonsense probably null
IGL02747:Ralgds APN 2 28548110 unclassified probably benign
IGL03135:Ralgds APN 2 28549088 missense probably damaging 0.99
PIT4458001:Ralgds UTSW 2 28542474 missense probably damaging 1.00
PIT4531001:Ralgds UTSW 2 28545214 nonsense probably null
R0049:Ralgds UTSW 2 28542379 synonymous silent
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0052:Ralgds UTSW 2 28544388 critical splice donor site probably null
R0285:Ralgds UTSW 2 28550569 splice site probably null
R0718:Ralgds UTSW 2 28549116 missense probably benign 0.37
R1755:Ralgds UTSW 2 28550546 missense probably damaging 0.99
R1966:Ralgds UTSW 2 28545875 missense probably damaging 0.96
R2873:Ralgds UTSW 2 28548769 splice site probably null
R2874:Ralgds UTSW 2 28548769 splice site probably null
R4082:Ralgds UTSW 2 28552271 utr 3 prime probably benign
R4342:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4344:Ralgds UTSW 2 28552095 missense probably damaging 1.00
R4647:Ralgds UTSW 2 28545520 critical splice donor site probably null
R4738:Ralgds UTSW 2 28545416 missense probably damaging 1.00
R4762:Ralgds UTSW 2 28552152 missense probably damaging 0.97
R5027:Ralgds UTSW 2 28552090 critical splice acceptor site probably null
R5320:Ralgds UTSW 2 28545212 missense probably damaging 1.00
R5738:Ralgds UTSW 2 28542526 intron probably benign
R5969:Ralgds UTSW 2 28542414 missense probably damaging 1.00
R6014:Ralgds UTSW 2 28543661 missense probably damaging 0.97
R6136:Ralgds UTSW 2 28550565 critical splice donor site probably null
R6137:Ralgds UTSW 2 28547588 missense probably damaging 0.99
R6583:Ralgds UTSW 2 28533644 missense probably damaging 0.99
R6618:Ralgds UTSW 2 28550511 missense probably benign 0.09
R6801:Ralgds UTSW 2 28548436 missense probably damaging 1.00
R7046:Ralgds UTSW 2 28540729 missense probably damaging 1.00
R7095:Ralgds UTSW 2 28549308 missense possibly damaging 0.83
R7276:Ralgds UTSW 2 28545872 missense probably damaging 1.00
R7399:Ralgds UTSW 2 28543655 missense possibly damaging 0.95
R7446:Ralgds UTSW 2 28545889 missense probably damaging 0.99
R7560:Ralgds UTSW 2 28547595 missense probably damaging 1.00
X0028:Ralgds UTSW 2 28548699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAAAGTCGTGCCCTACCACTG -3'
(R):5'- CTCTGCTGTTGGGCCTCACTAAAG -3'

Sequencing Primer
(F):5'- GCCCTACCACTGCCTGG -3'
(R):5'- TAGAGCCAGCCTGGGATAC -3'
Posted On2013-07-30