Incidental Mutation 'R0654:Ttc39b'
ID62423
Institutional Source Beutler Lab
Gene Symbol Ttc39b
Ensembl Gene ENSMUSG00000038172
Gene Nametetratricopeptide repeat domain 39B
Synonyms9130422G05Rik, 1810054D07Rik
MMRRC Submission 038839-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0654 (G1)
Quality Score100
Status Not validated
Chromosome4
Chromosomal Location83220300-83324255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83241701 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 413 (M413L)
Ref Sequence ENSEMBL: ENSMUSP00000099887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048274] [ENSMUST00000102823]
Predicted Effect probably benign
Transcript: ENSMUST00000048274
AA Change: M413L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000040590
Gene: ENSMUSG00000038172
AA Change: M413L

DomainStartEndE-ValueType
Pfam:DUF3808 75 478 2.2e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102823
AA Change: M413L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099887
Gene: ENSMUSG00000038172
AA Change: M413L

DomainStartEndE-ValueType
Pfam:DUF3808 75 533 3.6e-167 PFAM
Pfam:TPR_8 329 360 4.5e-3 PFAM
Pfam:TPR_6 563 594 6.9e-5 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb13 A C 13: 3,642,092 H24P probably damaging Het
Avpr1b T A 1: 131,599,742 M1K probably null Het
Baz1a T C 12: 54,911,397 E1023G probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Cfap157 C T 2: 32,779,942 V210M probably damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Dchs1 A G 7: 105,772,349 I288T probably damaging Het
Far2 T C 6: 148,175,141 F494S possibly damaging Het
Fibin T A 2: 110,362,617 D60V probably damaging Het
Fnd3c2 G A X: 106,247,154 T302I possibly damaging Het
Foxp3 A G X: 7,591,400 I281V probably benign Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Gria4 T A 9: 4,464,372 Q530L probably benign Het
Hivep1 A C 13: 42,159,756 D1824A probably benign Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Map3k21 C A 8: 125,942,020 L782I probably benign Het
Nphs2 A C 1: 156,318,747 T98P probably damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pkd2l1 A G 19: 44,157,631 probably null Het
Rbm28 A T 6: 29,128,578 S48R probably damaging Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scg3 T A 9: 75,665,735 I305F probably damaging Het
Slc22a1 T A 17: 12,662,792 N310I probably damaging Het
Slc26a9 T C 1: 131,765,030 V700A probably benign Het
Snx15 T C 19: 6,121,885 I140V probably benign Het
Spryd3 C T 15: 102,128,534 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tbl1xr1 T A 3: 22,203,994 probably null Het
Tmcc1 A T 6: 116,042,990 H281Q probably benign Het
Vmn2r101 C A 17: 19,590,111 H386Q probably benign Het
Zfp651 T C 9: 121,763,261 F251L probably benign Het
Other mutations in Ttc39b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Ttc39b APN 4 83244039 splice site probably benign
IGL02118:Ttc39b APN 4 83297949 missense probably damaging 1.00
IGL02860:Ttc39b APN 4 83263746 missense probably benign 0.14
IGL03008:Ttc39b APN 4 83247695 missense probably benign 0.00
IGL03136:Ttc39b APN 4 83237280 missense probably damaging 0.97
IGL03310:Ttc39b APN 4 83247659 missense probably benign 0.00
IGL03409:Ttc39b APN 4 83260956 missense probably damaging 1.00
R0536:Ttc39b UTSW 4 83227198 missense probably damaging 1.00
R1690:Ttc39b UTSW 4 83227177 missense probably damaging 1.00
R1758:Ttc39b UTSW 4 83237349 missense probably damaging 1.00
R1933:Ttc39b UTSW 4 83232720 missense possibly damaging 0.87
R2221:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R2223:Ttc39b UTSW 4 83232762 missense probably benign 0.00
R4182:Ttc39b UTSW 4 83237301 missense probably damaging 1.00
R4746:Ttc39b UTSW 4 83244103 missense probably benign 0.01
R4984:Ttc39b UTSW 4 83242209 missense probably benign 0.05
R5328:Ttc39b UTSW 4 83261941 missense probably damaging 1.00
R5360:Ttc39b UTSW 4 83261847 missense probably damaging 1.00
R5429:Ttc39b UTSW 4 83243953 missense possibly damaging 0.50
R5646:Ttc39b UTSW 4 83244070 missense probably damaging 1.00
R6353:Ttc39b UTSW 4 83230493 missense probably benign 0.07
R6681:Ttc39b UTSW 4 83240048 intron probably benign
R6873:Ttc39b UTSW 4 83246276 missense probably damaging 1.00
R7274:Ttc39b UTSW 4 83261851 missense possibly damaging 0.95
R7414:Ttc39b UTSW 4 83242222 missense probably damaging 0.99
R7536:Ttc39b UTSW 4 83239978 nonsense probably null
X0064:Ttc39b UTSW 4 83260939 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCATGCTGGCTCTCAGCCAAATTC -3'
(R):5'- TCCAGGCAGGATGTTGCTAGGATG -3'

Sequencing Primer
(F):5'- cagagatggctcagcgg -3'
(R):5'- AATTGCAGGTGCTGTCCTCTAAG -3'
Posted On2013-07-30