Incidental Mutation 'R8126:Evl'
List |< first << previous [record 15 of 43] next >> last >|
ID631774
Institutional Source Beutler Lab
Gene Symbol Evl
Ensembl Gene ENSMUSG00000021262
Gene NameEna-vasodilator stimulated phosphoprotein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8126 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location108554720-108688516 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 108681524 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 295 (R295*)
Ref Sequence ENSEMBL: ENSMUSP00000152364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021689] [ENSMUST00000077735] [ENSMUST00000109854] [ENSMUST00000172409] [ENSMUST00000223109]
Predicted Effect probably null
Transcript: ENSMUST00000021689
AA Change: R308*
SMART Domains Protein: ENSMUSP00000021689
Gene: ENSMUSG00000021262
AA Change: R308*

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 375 411 2.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000077735
AA Change: R308*
SMART Domains Protein: ENSMUSP00000076916
Gene: ENSMUSG00000021262
AA Change: R308*

DomainStartEndE-ValueType
WH1 1 109 7.72e-53 SMART
low complexity region 172 204 N/A INTRINSIC
low complexity region 216 228 N/A INTRINSIC
low complexity region 240 251 N/A INTRINSIC
Pfam:VASP_tetra 353 392 2e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109854
AA Change: R314*
SMART Domains Protein: ENSMUSP00000105480
Gene: ENSMUSG00000021262
AA Change: R314*

DomainStartEndE-ValueType
WH1 7 115 1.87e-51 SMART
low complexity region 178 210 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 246 257 N/A INTRINSIC
Pfam:VASP_tetra 359 398 7.1e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000172409
AA Change: R295*
SMART Domains Protein: ENSMUSP00000133072
Gene: ENSMUSG00000021262
AA Change: R295*

DomainStartEndE-ValueType
WH1 1 96 5.82e-39 SMART
low complexity region 159 191 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
Pfam:VASP_tetra 361 400 1.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222255
Predicted Effect probably null
Transcript: ENSMUST00000223109
AA Change: R295*
Predicted Effect probably benign
Transcript: ENSMUST00000223548
Meta Mutation Damage Score 0.9757 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 95% (42/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable with no apparent defects in gross morphology or histology. Mice homozygous for a different knock-out allele are viable and fertile but display defects in monocyte migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 A T 13: 81,440,225 V4414E possibly damaging Het
Aplp1 T A 7: 30,441,739 D299V probably damaging Het
Atad2 T C 15: 58,105,591 I841M probably benign Het
BC067074 T A 13: 113,368,163 I1942N Het
Bdp1 T C 13: 100,056,282 E1348G probably damaging Het
Cacna1a A G 8: 84,633,252 T1948A probably benign Het
Cdh12 T C 15: 21,558,307 Y431H probably benign Het
Cfap74 C A 4: 155,427,374 D446E Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Col4a4 T C 1: 82,453,286 T1632A unknown Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Cstl1 A G 2: 148,754,671 E98G probably benign Het
Ddx49 A T 8: 70,295,596 I303N probably damaging Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Gm13083 T A 4: 143,617,065 C312S possibly damaging Het
Gm14295 A G 2: 176,810,865 D716G probably benign Het
Gsap T A 5: 21,270,012 H556Q probably benign Het
Hsp90b1 T C 10: 86,694,382 I538V probably damaging Het
Ighv1-49 C T 12: 115,055,610 probably benign Het
Lrrk1 T C 7: 66,292,315 N725S probably damaging Het
Mfsd4b2 A G 10: 39,921,988 S124P probably benign Het
Ncoa1 A T 12: 4,290,951 L827Q probably damaging Het
Ncor2 T C 5: 125,106,204 N59D unknown Het
Nfkbid T A 7: 30,424,374 S120T probably benign Het
Nktr T C 9: 121,746,448 Y341H probably damaging Het
Npat T C 9: 53,552,334 V139A probably benign Het
Olfr290 T A 7: 84,915,906 N42K probably damaging Het
Plxnb2 T C 15: 89,163,303 D721G probably benign Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Ppp3ca T A 3: 136,903,191 D348E probably damaging Het
Rnf146 T C 10: 29,347,376 I171M probably damaging Het
Snrpa G T 7: 27,192,948 F62L possibly damaging Het
Spata3 C T 1: 86,024,353 R110C unknown Het
Tbc1d2b T C 9: 90,222,316 H591R probably benign Het
Tnfsf8 T G 4: 63,834,186 D214A possibly damaging Het
Trdmt1 C T 2: 13,520,005 R213H probably benign Het
Uspl1 C T 5: 149,214,620 L877F probably damaging Het
Vmn1r22 C A 6: 57,900,684 V103F possibly damaging Het
Vmn2r102 T C 17: 19,660,450 S18P probably benign Het
Vmn2r-ps117 A T 17: 18,822,552 Y74F probably benign Het
Wdr90 A G 17: 25,848,977 F1429S possibly damaging Het
Zdhhc20 C A 14: 57,846,945 V238F probably damaging Het
Other mutations in Evl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02546:Evl APN 12 108648419 missense possibly damaging 0.47
IGL03391:Evl APN 12 108676099 splice site probably null
Husk UTSW 12 108648460 missense probably damaging 1.00
Pencil UTSW 12 108681524 nonsense probably null
Shaving UTSW 12 108648308 splice site probably benign
R0366:Evl UTSW 12 108686048 critical splice acceptor site probably null
R0603:Evl UTSW 12 108648422 missense probably damaging 1.00
R1843:Evl UTSW 12 108652996 missense probably damaging 1.00
R3431:Evl UTSW 12 108648308 splice site probably benign
R3432:Evl UTSW 12 108648308 splice site probably benign
R4915:Evl UTSW 12 108686106 missense probably damaging 1.00
R5137:Evl UTSW 12 108681522 missense probably benign 0.00
R5688:Evl UTSW 12 108673353 critical splice donor site probably null
R5933:Evl UTSW 12 108683257 missense possibly damaging 0.60
R5950:Evl UTSW 12 108675553 missense probably benign 0.16
R6144:Evl UTSW 12 108653031 missense probably damaging 1.00
R7235:Evl UTSW 12 108648460 missense probably damaging 1.00
R7369:Evl UTSW 12 108686565 missense unknown
R7639:Evl UTSW 12 108686103 missense probably damaging 1.00
R7822:Evl UTSW 12 108648464 missense probably damaging 1.00
R7967:Evl UTSW 12 108681524 nonsense probably null
R7968:Evl UTSW 12 108681524 nonsense probably null
R7970:Evl UTSW 12 108681524 nonsense probably null
R7972:Evl UTSW 12 108681524 nonsense probably null
R7973:Evl UTSW 12 108681524 nonsense probably null
R8017:Evl UTSW 12 108681524 nonsense probably null
R8019:Evl UTSW 12 108681524 nonsense probably null
R8020:Evl UTSW 12 108681524 nonsense probably null
R8046:Evl UTSW 12 108681524 nonsense probably null
R8105:Evl UTSW 12 108681524 nonsense probably null
R8122:Evl UTSW 12 108681524 nonsense probably null
R8123:Evl UTSW 12 108681524 nonsense probably null
R8124:Evl UTSW 12 108681524 nonsense probably null
R8125:Evl UTSW 12 108681524 nonsense probably null
R8298:Evl UTSW 12 108652973 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CCAGCCTAGTGATGTAAGGATTG -3'
(R):5'- TTAGCTGGACCAGATCAAGGG -3'

Sequencing Primer
(F):5'- TGTGCTCTTGACTGAGAGACATAGAC -3'
(R):5'- ACACCTGCCTAGCTGTCTG -3'
Posted On2020-06-30