Mutagenetix > Incidental Mutation

Incidental Mutation 'R8167:Tgfb2'

633814

Institutional Source

Beutler Lab

Gene Symbol

Tgfb2

Ensembl Gene

ENSMUSG00000039239

Gene Name

transforming growth factor, beta 2

Synonyms

Tgfb-2, Tgf-beta2

MMRRC Submission

067593-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8167 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

186354989-186438186 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 186422942 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 136 (S136P)

Ref Sequence

ENSEMBL: ENSMUSP00000142149 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045288] [ENSMUST00000195201]

AlphaFold

P27090

Predicted Effect

probably benign
Transcript: ENSMUST00000045288

SMART Domains

Protein: ENSMUSP00000043849
Gene: ENSMUSG00000039239

Domain	Start	End	E-Value	Type
Pfam:TGFb_propeptide	20	284	1.1e-38	PFAM
TGFB	317	414	1.25e-37	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195201
AA Change: S136P

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000142149
Gene: ENSMUSG00000039239
AA Change: S136P

Domain	Start	End	E-Value	Type
Pfam:TGFb_propeptide	9	138	2.4e-9	PFAM
Pfam:TGFb_propeptide	152	311	1.4e-23	PFAM
TGFB	345	442	6.1e-40	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Mice lacking a functional copy of this gene display developmental defects in multiple organs and perinatal lethality. Heterozygous mutant mice exhibit aortic root aneurysm. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lungs, skull, limbs, spinal column, eyes, inner ears, and urogenital system, and perinatal mortality. Heterozygotes show abnormalities of the Cowpers' gland and intestinal mucosa. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406B18Rik	T	A	7: 43,147,288 (GRCm39)	I315F	possibly damaging	Het
Aadacl2fm3	T	A	3: 59,784,632 (GRCm39)	D368E	probably benign	Het
Acin1	G	A	14: 54,902,337 (GRCm39)	T485I	probably benign	Het
Adamts2	A	T	11: 50,670,541 (GRCm39)	I552F	probably damaging	Het
Anapc11	T	A	11: 120,490,112 (GRCm39)	N9K	probably benign	Het
Arhgef18	A	T	8: 3,403,636 (GRCm39)		probably benign	Het
Atp9b	T	C	18: 80,890,398 (GRCm39)	T314A		Het
Birc6	T	A	17: 74,950,389 (GRCm39)	I3214N	probably damaging	Het
Catsperb	A	G	12: 101,557,714 (GRCm39)	I762V	probably benign	Het
Cblb	T	A	16: 51,986,365 (GRCm39)	M536K	probably benign	Het
Ccdc85c	C	A	12: 108,240,759 (GRCm39)	A212S	unknown	Het
Cdh23	T	A	10: 60,150,162 (GRCm39)	D2561V	probably benign	Het
Cdh23	T	A	10: 60,173,472 (GRCm39)	Y1672F	probably damaging	Het
Cep83	T	C	10: 94,564,579 (GRCm39)	S173P	possibly damaging	Het
Ctc1	C	T	11: 68,918,584 (GRCm39)	P530S	probably damaging	Het
D630045J12Rik	A	G	6: 38,167,484 (GRCm39)		probably null	Het
Dnah7b	A	T	1: 46,292,671 (GRCm39)	I3019F	possibly damaging	Het
Dsc1	T	C	18: 20,230,258 (GRCm39)	D349G	probably damaging	Het
Ehd2	C	G	7: 15,697,917 (GRCm39)	G107R	probably damaging	Het
Epha3	A	T	16: 63,388,804 (GRCm39)	W816R	probably damaging	Het
Fam135b	T	A	15: 71,404,840 (GRCm39)	S69C	probably null	Het
Fbxo43	A	G	15: 36,151,917 (GRCm39)	F600S	probably damaging	Het
Flnc	A	T	6: 29,455,921 (GRCm39)	D2117V	probably damaging	Het
Gas2l3	T	A	10: 89,262,342 (GRCm39)	T127S	probably damaging	Het
Gli3	T	G	13: 15,900,228 (GRCm39)	L1205R	probably benign	Het
Gm17093	A	T	14: 44,758,139 (GRCm39)	I107F		Het
Gm7298	T	A	6: 121,761,414 (GRCm39)	C1323*	probably null	Het
H2-D1	A	G	17: 35,485,741 (GRCm39)	T89A		Het
Hira	T	G	16: 18,715,259 (GRCm39)	D52E	probably benign	Het
Ighv6-6	G	C	12: 114,398,525 (GRCm39)	Y80*	probably null	Het
Kat6b	C	T	14: 21,719,953 (GRCm39)	T1435I	probably damaging	Het
Kcna1	C	A	6: 126,620,443 (GRCm39)		probably benign	Het
Kif24	C	A	4: 41,392,957 (GRCm39)	R1284L	possibly damaging	Het
Kremen2	A	C	17: 23,962,314 (GRCm39)	C173G	probably damaging	Het
Krtap24-1	G	C	16: 88,408,707 (GRCm39)	Q140E	probably benign	Het
Lrrc66	C	A	5: 73,786,952 (GRCm39)	G133*	probably null	Het
Mast1	C	A	8: 85,647,987 (GRCm39)	R498L	probably damaging	Het
Myom3	T	C	4: 135,534,504 (GRCm39)	I1231T	possibly damaging	Het
Nid2	G	A	14: 19,860,131 (GRCm39)	V1350I	possibly damaging	Het
Or4f59	A	T	2: 111,872,789 (GRCm39)	V196D	possibly damaging	Het
Or8j3c	A	G	2: 86,253,484 (GRCm39)	C179R	probably damaging	Het
Or9r3	T	C	10: 129,948,350 (GRCm39)	Q103R	probably damaging	Het
Pde4a	A	G	9: 21,117,469 (GRCm39)	D577G	possibly damaging	Het
Pde4d	T	A	13: 109,578,855 (GRCm39)	N36K	probably benign	Het
Plekhg1	A	T	10: 3,907,452 (GRCm39)	S845C		Het
Plekhg1	G	A	10: 3,907,453 (GRCm39)	S845N		Het
Plod1	C	T	4: 148,004,658 (GRCm39)	D481N	probably damaging	Het
Plxna4	T	A	6: 32,493,981 (GRCm39)	M212L	probably damaging	Het
Ppip5k1	C	A	2: 121,173,282 (GRCm39)	E464*	probably null	Het
Raph1	T	A	1: 60,529,270 (GRCm39)	M664L	unknown	Het
Rbm11	A	C	16: 75,395,673 (GRCm39)	M115L	probably benign	Het
Rerg	T	C	6: 137,034,869 (GRCm39)	H45R	possibly damaging	Het
Rnf43	A	G	11: 87,618,232 (GRCm39)	E47G	probably benign	Het
Rsph1	A	G	17: 31,496,260 (GRCm39)		probably benign	Het
Safb	A	G	17: 56,892,286 (GRCm39)	E42G	unknown	Het
Scn1a	A	T	2: 66,155,182 (GRCm39)	D592E	probably damaging	Het
Sdf4	T	G	4: 156,093,379 (GRCm39)	V237G	possibly damaging	Het
Slc44a2	C	A	9: 21,258,068 (GRCm39)	H439Q	possibly damaging	Het
Smg7	A	T	1: 152,720,123 (GRCm39)	N761K	possibly damaging	Het
Snrpb2	A	G	2: 142,910,284 (GRCm39)	E114G	probably benign	Het
Spmip11	A	G	15: 98,486,548 (GRCm39)	H106R	probably benign	Het
Ssh1	T	C	5: 114,090,051 (GRCm39)	D346G	possibly damaging	Het
Svopl	T	A	6: 37,993,979 (GRCm39)	I351F	probably damaging	Het
Thsd7a	A	T	6: 12,317,400 (GRCm39)	L1636*	probably null	Het
Tmc2	A	G	2: 130,083,488 (GRCm39)	T482A	probably benign	Het
Tnk2	C	A	16: 32,499,080 (GRCm39)	P798T	probably damaging	Het
Trim5	T	C	7: 103,927,630 (GRCm39)	Y170C	probably damaging	Het
Ttll10	T	C	4: 156,129,213 (GRCm39)	M310V	probably null	Het
Unc13c	T	A	9: 73,643,985 (GRCm39)	T1160S	probably damaging	Het
Usp25	A	T	16: 76,904,819 (GRCm39)	D795V	probably damaging	Het
Usp28	T	A	9: 48,949,148 (GRCm39)	V914E	probably damaging	Het
Utrn	A	T	10: 12,547,558 (GRCm39)	C1627*	probably null	Het
Vmn1r28	C	A	6: 58,243,052 (GRCm39)	F298L	noncoding transcript	Het
Vps29	T	C	5: 122,500,877 (GRCm39)	S69P	possibly damaging	Het
Zfp703	T	A	8: 27,469,782 (GRCm39)	L482H	probably damaging	Het

Other mutations in Tgfb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Tgfb2	APN	1	186,436,784 (GRCm39)	missense	probably benign	0.39
IGL01304:Tgfb2	APN	1	186,357,670 (GRCm39)	missense	probably damaging	0.99
IGL03028:Tgfb2	APN	1	186,362,806 (GRCm39)	critical splice donor site	probably null
PIT4486001:Tgfb2	UTSW	1	186,422,924 (GRCm39)	missense	probably benign	0.04
R2017:Tgfb2	UTSW	1	186,362,962 (GRCm39)	nonsense	probably null
R2880:Tgfb2	UTSW	1	186,436,752 (GRCm39)	missense	probably damaging	1.00
R4182:Tgfb2	UTSW	1	186,361,222 (GRCm39)	missense	possibly damaging	0.95
R4292:Tgfb2	UTSW	1	186,364,735 (GRCm39)	missense	probably damaging	1.00
R4478:Tgfb2	UTSW	1	186,364,696 (GRCm39)	missense	probably damaging	1.00
R4801:Tgfb2	UTSW	1	186,361,110 (GRCm39)	nonsense	probably null
R4802:Tgfb2	UTSW	1	186,361,110 (GRCm39)	nonsense	probably null
R5247:Tgfb2	UTSW	1	186,382,111 (GRCm39)	splice site	probably null
R5254:Tgfb2	UTSW	1	186,436,680 (GRCm39)	missense	probably damaging	1.00
R5614:Tgfb2	UTSW	1	186,357,710 (GRCm39)	missense	probably benign	0.21
R5988:Tgfb2	UTSW	1	186,436,778 (GRCm39)	missense	probably benign	0.05
R6898:Tgfb2	UTSW	1	186,364,697 (GRCm39)	missense	probably damaging	1.00
R6961:Tgfb2	UTSW	1	186,382,032 (GRCm39)	missense	possibly damaging	0.67
R7098:Tgfb2	UTSW	1	186,362,834 (GRCm39)	missense	probably damaging	1.00
R7346:Tgfb2	UTSW	1	186,382,077 (GRCm39)	missense	probably benign	0.00
R7729:Tgfb2	UTSW	1	186,362,954 (GRCm39)	missense	possibly damaging	0.94
R8825:Tgfb2	UTSW	1	186,361,136 (GRCm39)	missense	probably damaging	1.00
R8884:Tgfb2	UTSW	1	186,364,907 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAGCGTGTCACTTCAAAG -3'
(R):5'- GGATGGTAAGACTAGCCAGC -3'

Sequencing Primer
(F):5'- AGCGTGTCACTTCAAAGCTAGTC -3'
(R):5'- TGGTAAGACTAGCCAGCAAGTCC -3'

Posted On

2020-07-13