Incidental Mutation 'R8167:Olfr1312'
ID633817
Institutional Source Beutler Lab
Gene Symbol Olfr1312
Ensembl Gene ENSMUSG00000074947
Gene Nameolfactory receptor 1312
SynonymsGA_x6K02T2Q125-73090482-73089529, MOR245-20
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8167 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location112038068-112050238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112042444 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 196 (V196D)
Ref Sequence ENSEMBL: ENSMUSP00000097195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099600]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099600
AA Change: V196D

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097195
Gene: ENSMUSG00000074947
AA Change: V196D

DomainStartEndE-ValueType
Pfam:7tm_4 27 302 1.6e-43 PFAM
Pfam:7tm_1 38 284 1.3e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,588,667 H106R probably benign Het
4931406B18Rik T A 7: 43,497,864 I315F possibly damaging Het
A430078G23Rik A T 8: 3,353,636 probably benign Het
Acin1 G A 14: 54,664,880 T485I probably benign Het
Adamts2 A T 11: 50,779,714 I552F probably damaging Het
Anapc11 T A 11: 120,599,286 N9K probably benign Het
Atp9b T C 18: 80,847,183 T314A Het
Birc6 T A 17: 74,643,394 I3214N probably damaging Het
Catsperb A G 12: 101,591,455 I762V probably benign Het
Cblb T A 16: 52,166,002 M536K probably benign Het
Ccdc85c C A 12: 108,274,500 A212S unknown Het
Cdh23 T A 10: 60,314,383 D2561V probably benign Het
Cdh23 T A 10: 60,337,693 Y1672F probably damaging Het
Cep83 T C 10: 94,728,717 S173P possibly damaging Het
Ctc1 C T 11: 69,027,758 P530S probably damaging Het
D630045J12Rik A G 6: 38,190,549 probably null Het
Dnah7b A T 1: 46,253,511 I3019F possibly damaging Het
Dsc1 T C 18: 20,097,201 D349G probably damaging Het
Ehd2 C G 7: 15,963,992 G107R probably damaging Het
Epha3 A T 16: 63,568,441 W816R probably damaging Het
Fam135b T A 15: 71,532,991 S69C probably null Het
Fbxo43 A G 15: 36,151,771 F600S probably damaging Het
Flnc A T 6: 29,455,922 D2117V probably damaging Het
Gas2l3 T A 10: 89,426,480 T127S probably damaging Het
Gli3 T G 13: 15,725,643 L1205R probably benign Het
Gm17093 A T 14: 44,520,682 I107F Het
Gm7298 T A 6: 121,784,455 C1323* probably null Het
Gm8298 T A 3: 59,877,211 D368E probably benign Het
H2-D1 A G 17: 35,266,765 T89A Het
Hira T G 16: 18,896,509 D52E probably benign Het
Ighv6-6 G C 12: 114,434,905 Y80* probably null Het
Kat6b C T 14: 21,669,885 T1435I probably damaging Het
Kcna1 C A 6: 126,643,480 probably benign Het
Kif24 C A 4: 41,392,957 R1284L possibly damaging Het
Kremen2 A C 17: 23,743,340 C173G probably damaging Het
Krtap24-1 G C 16: 88,611,819 Q140E probably benign Het
Lrrc66 C A 5: 73,629,609 G133* probably null Het
Mast1 C A 8: 84,921,358 R498L probably damaging Het
Myom3 T C 4: 135,807,193 I1231T possibly damaging Het
Nid2 G A 14: 19,810,063 V1350I possibly damaging Het
Olfr1062 A G 2: 86,423,140 C179R probably damaging Het
Olfr823 T C 10: 130,112,481 Q103R probably damaging Het
Pde4a A G 9: 21,206,173 D577G possibly damaging Het
Pde4d T A 13: 109,442,321 N36K probably benign Het
Plekhg1 A T 10: 3,957,452 S845C Het
Plekhg1 G A 10: 3,957,453 S845N Het
Plod1 C T 4: 147,920,201 D481N probably damaging Het
Plxna4 T A 6: 32,517,046 M212L probably damaging Het
Ppip5k1 C A 2: 121,342,801 E464* probably null Het
Raph1 T A 1: 60,490,111 M664L unknown Het
Rbm11 A C 16: 75,598,785 M115L probably benign Het
Rerg T C 6: 137,057,871 H45R possibly damaging Het
Rnf43 A G 11: 87,727,406 E47G probably benign Het
Rsph1 A G 17: 31,277,286 probably benign Het
Safb A G 17: 56,585,286 E42G unknown Het
Scn1a A T 2: 66,324,838 D592E probably damaging Het
Sdf4 T G 4: 156,008,922 V237G possibly damaging Het
Slc44a2 C A 9: 21,346,772 H439Q possibly damaging Het
Smg7 A T 1: 152,844,372 N761K possibly damaging Het
Snrpb2 A G 2: 143,068,364 E114G probably benign Het
Ssh1 T C 5: 113,951,990 D346G possibly damaging Het
Svopl T A 6: 38,017,044 I351F probably damaging Het
Tgfb2 A G 1: 186,690,745 S136P possibly damaging Het
Thsd7a A T 6: 12,317,401 L1636* probably null Het
Tmc2 A G 2: 130,241,568 T482A probably benign Het
Tnk2 C A 16: 32,680,262 P798T probably damaging Het
Trim5 T C 7: 104,278,423 Y170C probably damaging Het
Ttll10 T C 4: 156,044,756 M310V probably null Het
Unc13c T A 9: 73,736,703 T1160S probably damaging Het
Usp25 A T 16: 77,107,931 D795V probably damaging Het
Usp28 T A 9: 49,037,848 V914E probably damaging Het
Utrn A T 10: 12,671,814 C1627* probably null Het
Vmn1r28 C A 6: 58,266,067 F298L noncoding transcript Het
Vps29 T C 5: 122,362,814 S69P possibly damaging Het
Zfp703 T A 8: 26,979,754 L482H probably damaging Het
Other mutations in Olfr1312
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Olfr1312 APN 2 112042371 missense probably benign 0.00
IGL01650:Olfr1312 APN 2 112042375 missense possibly damaging 0.84
IGL02390:Olfr1312 APN 2 112042711 missense possibly damaging 0.84
IGL03392:Olfr1312 APN 2 112042976 missense probably benign 0.00
R1170:Olfr1312 UTSW 2 112042215 missense probably benign 0.45
R1620:Olfr1312 UTSW 2 112042246 missense probably benign 0.07
R2083:Olfr1312 UTSW 2 112042553 missense probably benign 0.05
R3605:Olfr1312 UTSW 2 112042823 missense probably benign
R4182:Olfr1312 UTSW 2 112042528 missense probably damaging 1.00
R5739:Olfr1312 UTSW 2 112042783 missense probably damaging 0.99
R6321:Olfr1312 UTSW 2 112042768 missense probably benign 0.07
R7231:Olfr1312 UTSW 2 112042366 missense probably damaging 1.00
R7365:Olfr1312 UTSW 2 112043014 missense possibly damaging 0.95
R7673:Olfr1312 UTSW 2 112042580 missense probably benign
R7978:Olfr1312 UTSW 2 112042178 missense possibly damaging 0.92
R8112:Olfr1312 UTSW 2 112042637 missense probably damaging 1.00
Z1177:Olfr1312 UTSW 2 112042655 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGAAACTTATCCAGGTGTG -3'
(R):5'- ATTATGAGCCCAAGGGTGTG -3'

Sequencing Primer
(F):5'- CAGAAACTTATCCAGGTGTGTGTAAG -3'
(R):5'- CCCAAGGGTGTGCATCTTG -3'
Posted On2020-07-13