Incidental Mutation 'R8189:Olfr172'
ID635043
Institutional Source Beutler Lab
Gene Symbol Olfr172
Ensembl Gene ENSMUSG00000071510
Gene Nameolfactory receptor 172
SynonymsGA_x54KRFPKG5P-54930346-54929417, MOR184-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8189 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location58759544-58763176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58760925 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 84 (N84Y)
Ref Sequence ENSEMBL: ENSMUSP00000093690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095991]
Predicted Effect probably damaging
Transcript: ENSMUST00000095991
AA Change: N84Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093690
Gene: ENSMUSG00000071510
AA Change: N84Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.9e-52 PFAM
Pfam:7tm_1 41 290 3e-19 PFAM
Meta Mutation Damage Score 0.4866 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030617O03Rik G A 12: 100,838,630 E127K probably benign Het
Abca12 A G 1: 71,285,726 I1531T probably damaging Het
Ankrd13d G A 19: 4,270,852 P516S probably benign Het
Bag6 A G 17: 35,145,238 probably null Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Cchcr1 A G 17: 35,526,666 I422V probably benign Het
Ceacam1 A G 7: 25,473,918 S282P probably damaging Het
Chka G T 19: 3,875,759 E159* probably null Het
Ckmt2 T C 13: 91,855,775 Y368C probably damaging Het
Cngb1 TTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGGCTCTGG TTCTGGCTCTGGCTCTGGCTCTGG 8: 95,303,620 probably benign Het
Ctsq A G 13: 61,037,155 L239P probably damaging Het
D630045J12Rik A G 6: 38,158,171 L1358P probably damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
Fgd6 T C 10: 94,074,215 L794P probably benign Het
Fgfr2 G A 7: 130,172,899 T654I probably damaging Het
Gmeb2 G A 2: 181,277,967 T38M probably damaging Het
Gria1 T C 11: 57,217,799 F243L probably benign Het
Gria2 A T 3: 80,722,182 D244E probably damaging Het
Ints2 T A 11: 86,215,570 I1005F probably damaging Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Kmt2b A G 7: 30,569,331 F2658L probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mcf2l A G 8: 12,963,164 D27G probably damaging Het
Mrgprb2 G T 7: 48,552,754 Y74* probably null Het
Nrcam C A 12: 44,570,508 P740T possibly damaging Het
Nrxn1 C T 17: 90,704,209 V331I probably damaging Het
Olfr1293-ps T C 2: 111,527,773 V153A Het
Olfr47 T C 6: 43,236,079 V157A probably benign Het
Olfr472 A G 7: 107,902,732 N5S probably damaging Het
Olfr792 T A 10: 129,541,253 C239S probably damaging Het
Pla2g4a A G 1: 149,857,586 F479L probably benign Het
Scaper A T 9: 55,912,120 F104I probably damaging Het
Serpinb3c A T 1: 107,276,309 C58S probably benign Het
Setdb1 A G 3: 95,346,711 V260A probably damaging Het
Shank3 A G 15: 89,549,236 T1395A probably benign Het
Skiv2l2 T A 13: 112,891,981 R628S possibly damaging Het
Slc35b4 A G 6: 34,167,635 I95T probably damaging Het
Trpm5 A G 7: 143,081,838 V599A probably benign Het
Ttk A G 9: 83,847,219 S352G probably benign Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Usp17le C T 7: 104,769,348 D196N probably damaging Het
Vmn2r15 A G 5: 109,286,847 F664L probably benign Het
Vmn2r94 A T 17: 18,258,356 L43Q probably damaging Het
Other mutations in Olfr172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03006:Olfr172 APN 16 58761148 missense probably benign 0.01
R1210:Olfr172 UTSW 16 58761050 missense probably damaging 1.00
R1521:Olfr172 UTSW 16 58760853 missense probably damaging 1.00
R1710:Olfr172 UTSW 16 58761141 missense probably benign 0.02
R4730:Olfr172 UTSW 16 58760742 missense probably benign 0.00
R4784:Olfr172 UTSW 16 58760548 missense probably damaging 1.00
R4924:Olfr172 UTSW 16 58760619 nonsense probably null
R5213:Olfr172 UTSW 16 58760621 missense probably damaging 1.00
R5967:Olfr172 UTSW 16 58760362 missense probably damaging 1.00
R7022:Olfr172 UTSW 16 58761119 missense probably benign 0.00
R7259:Olfr172 UTSW 16 58760505 missense possibly damaging 0.92
R7745:Olfr172 UTSW 16 58760419 nonsense probably null
R7983:Olfr172 UTSW 16 58761014 missense probably benign 0.37
R8123:Olfr172 UTSW 16 58761174 start codon destroyed possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TATGAAGGCTCCCGTGATCATC -3'
(R):5'- TTTACAAACCACCCTGAAATGAAGG -3'

Sequencing Primer
(F):5'- AAGGCTCCCGTGATCATCTGAAG -3'
(R):5'- CCTGAAATGAAGGGCCTTCTATTTGC -3'
Posted On2020-07-13