Incidental Mutation 'R8269:Vmn2r55'
ID639492
Institutional Source Beutler Lab
Gene Symbol Vmn2r55
Ensembl Gene ENSMUSG00000091045
Gene Namevomeronasal 2, receptor 55
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R8269 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12651706-12684991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12670658 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 273 (T273S)
Ref Sequence ENSEMBL: ENSMUSP00000133483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167771] [ENSMUST00000172743]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167771
AA Change: T273S

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132834
Gene: ENSMUSG00000091045
AA Change: T273S

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 398 6.1e-54 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172743
AA Change: T273S

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133483
Gene: ENSMUSG00000091045
AA Change: T273S

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.4e-57 PFAM
Pfam:7tm_3 525 762 3.7e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,246,325 T489A probably benign Het
Adgra3 A T 5: 49,963,737 C850S probably damaging Het
Ago3 T A 4: 126,376,928 K258* probably null Het
Akap11 G A 14: 78,513,378 T523I Het
Amigo2 G T 15: 97,246,231 N103K possibly damaging Het
Arfgap3 A C 15: 83,310,341 S377A probably benign Het
Arhgap39 G T 15: 76,751,742 Q98K probably benign Het
Atp1a4 T C 1: 172,232,325 D779G probably damaging Het
Bckdhb T C 9: 84,122,364 I388T probably benign Het
Ccdc144b A T 3: 36,046,713 N103K possibly damaging Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Cd109 A G 9: 78,665,682 K496R probably benign Het
Cnot1 A G 8: 95,751,761 F979L probably damaging Het
D130040H23Rik T A 8: 69,303,148 S402T probably benign Het
Dmtf1 A T 5: 9,132,500 Y211* probably null Het
Dnah6 A G 6: 73,168,827 probably null Het
Emc10 G T 7: 44,491,984 Q227K possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Exosc4 A T 15: 76,327,532 I14L probably benign Het
Fat2 T C 11: 55,282,709 T2393A possibly damaging Het
Flg2 A T 3: 93,201,880 H405L possibly damaging Het
Gin1 T A 1: 97,783,204 M204K probably damaging Het
Gm14085 C T 2: 122,521,688 H336Y probably damaging Het
Gnal A G 18: 67,135,622 D193G possibly damaging Het
Itpr3 G T 17: 27,093,284 R554L possibly damaging Het
Lipc A G 9: 70,820,373 L149P probably damaging Het
Lrrc37a A G 11: 103,497,898 Y2234H unknown Het
Lsm14b T C 2: 180,032,614 S317P probably damaging Het
Mapk4 G C 18: 73,930,551 F533L probably damaging Het
Mgll T A 6: 88,813,948 Y183* probably null Het
Mrrf T A 2: 36,147,961 D81E possibly damaging Het
Ncan T A 8: 70,107,680 Q879L probably benign Het
Olfr1179 A T 2: 88,402,037 V299D probably damaging Het
Olfr492 A T 7: 108,323,569 C36S probably benign Het
Pcdhb10 A G 18: 37,414,009 K713E probably benign Het
Phkb A G 8: 86,029,582 D835G probably benign Het
Pld1 A G 3: 28,025,239 N63D probably benign Het
Pls1 G T 9: 95,761,970 T491K probably damaging Het
Plscr1 A G 9: 92,263,042 D35G unknown Het
Slc3a1 A G 17: 85,032,554 K180R probably benign Het
Suv39h1 G T X: 8,071,031 Q129K probably benign Het
Tbc1d8 A G 1: 39,426,088 V73A probably benign Het
Tmem161a T A 8: 70,181,958 V421E probably benign Het
Topbp1 C A 9: 103,328,593 P810Q possibly damaging Het
Ttc28 G A 5: 111,277,459 V1717M probably benign Het
Vwa5b2 A G 16: 20,604,438 D1062G probably damaging Het
Zcrb1 A G 15: 93,397,175 Y27H probably benign Het
Zfp128 G A 7: 12,890,736 G344R probably damaging Het
Other mutations in Vmn2r55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02684:Vmn2r55 APN 7 12670960 missense probably damaging 1.00
IGL03035:Vmn2r55 APN 7 12670816 missense probably benign 0.01
IGL03115:Vmn2r55 APN 7 12670631 missense probably damaging 1.00
IGL03251:Vmn2r55 APN 7 12671193 splice site probably benign
R0140:Vmn2r55 UTSW 7 12668177 missense possibly damaging 0.58
R0511:Vmn2r55 UTSW 7 12671018 missense possibly damaging 0.88
R1281:Vmn2r55 UTSW 7 12670898 missense probably benign 0.02
R1564:Vmn2r55 UTSW 7 12684751 missense probably damaging 1.00
R1602:Vmn2r55 UTSW 7 12652644 missense probably damaging 1.00
R1785:Vmn2r55 UTSW 7 12668184 missense probably damaging 0.98
R2939:Vmn2r55 UTSW 7 12651905 missense probably damaging 1.00
R2993:Vmn2r55 UTSW 7 12684955 missense probably damaging 1.00
R3151:Vmn2r55 UTSW 7 12670707 missense probably benign 0.06
R4272:Vmn2r55 UTSW 7 12668179 missense probably benign 0.38
R4589:Vmn2r55 UTSW 7 12670895 missense probably damaging 0.99
R4624:Vmn2r55 UTSW 7 12670700 missense possibly damaging 0.83
R4965:Vmn2r55 UTSW 7 12670551 missense possibly damaging 0.91
R5294:Vmn2r55 UTSW 7 12651864 missense probably damaging 1.00
R5364:Vmn2r55 UTSW 7 12670903 missense possibly damaging 0.51
R5395:Vmn2r55 UTSW 7 12651947 missense probably damaging 1.00
R5401:Vmn2r55 UTSW 7 12651944 missense probably benign
R5701:Vmn2r55 UTSW 7 12670565 missense probably benign 0.00
R5771:Vmn2r55 UTSW 7 12671032 missense probably damaging 1.00
R5846:Vmn2r55 UTSW 7 12670565 missense probably benign 0.05
R6148:Vmn2r55 UTSW 7 12668142 missense probably benign 0.01
R6159:Vmn2r55 UTSW 7 12651771 missense probably damaging 1.00
R6541:Vmn2r55 UTSW 7 12671012 missense probably damaging 1.00
R7286:Vmn2r55 UTSW 7 12652073 missense probably damaging 0.99
R7483:Vmn2r55 UTSW 7 12670828 missense probably benign 0.00
Z1177:Vmn2r55 UTSW 7 12651837 missense possibly damaging 0.83
Z1177:Vmn2r55 UTSW 7 12671179 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ATATTGTGCAGAGCATGGGC -3'
(R):5'- TCCAGCTCATCCTACATGGC -3'

Sequencing Primer
(F):5'- CATGGGCAATGCTGTAGACAG -3'
(R):5'- CATCCTACATGGCTTACTGGGTG -3'
Posted On2020-07-28