Incidental Mutation 'R8268:Themis3'
ID639560
Institutional Source Beutler Lab
Gene Symbol Themis3
Ensembl Gene ENSMUSG00000024105
Gene Namethymocyte selection associated family member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R8268 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location66555252-66594621 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66555791 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 391 (E391K)
Ref Sequence ENSEMBL: ENSMUSP00000024914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024914]
Predicted Effect probably benign
Transcript: ENSMUST00000024914
AA Change: E391K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024914
Gene: ENSMUSG00000024105
AA Change: E391K

DomainStartEndE-ValueType
Pfam:CABIT 17 262 2e-48 PFAM
Pfam:CABIT 272 533 3.5e-49 PFAM
low complexity region 556 566 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,457,317 C396S probably benign Het
Ccpg1 G A 9: 73,005,719 R179H probably damaging Het
Ciapin1 A G 8: 94,831,883 V67A probably benign Het
Col7a1 A G 9: 108,972,989 R2018G unknown Het
Dnah11 A T 12: 118,027,508 Y2374* probably null Het
Dnah7b G T 1: 46,356,576 M3879I probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Gm12258 A C 11: 58,854,258 probably null Het
Hpse A G 5: 100,699,041 L174S probably damaging Het
Hspa8 A G 9: 40,803,152 K248R probably damaging Het
Kcnt2 A C 1: 140,523,216 R744S probably damaging Het
Klhl32 G A 4: 24,800,843 probably benign Het
Mkrn3 A G 7: 62,418,522 L507P probably damaging Het
Myom2 T G 8: 15,129,157 F1330V probably damaging Het
Nr1d2 A G 14: 18,216,659 S170P probably damaging Het
Nt5dc1 T C 10: 34,310,411 D388G probably damaging Het
Olfr1121 C A 2: 87,371,988 A152E probably damaging Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr1352 T A 10: 78,983,997 V69E probably damaging Het
Olfr45 A G 7: 140,691,517 D204G probably damaging Het
Pigg T A 5: 108,338,643 S721T probably damaging Het
Prr5 T C 15: 84,702,991 L323P probably benign Het
Rapgef2 T A 3: 79,085,956 I742L probably benign Het
Rxrb A G 17: 34,035,776 S302G probably benign Het
Setd5 T G 6: 113,149,690 probably null Het
Sh3bgr A G 16: 96,224,474 T187A unknown Het
Sh3pxd2a C T 19: 47,267,594 R923H probably benign Het
Slc26a10 A G 10: 127,173,622 probably null Het
Slc9a1 T A 4: 133,370,623 V27E probably benign Het
Stard3nl A G 13: 19,376,459 S49P probably damaging Het
Stxbp2 G A 8: 3,632,234 V17I Het
Tia1 A G 6: 86,428,014 probably benign Het
Tmem167 T C 13: 90,104,435 F70S probably damaging Het
Trpm6 C A 19: 18,873,861 Q1729K possibly damaging Het
Tsc2 A C 17: 24,600,010 L1285W probably benign Het
Uchl4 A T 9: 64,235,509 I91F probably damaging Het
Wdfy3 C T 5: 101,941,610 A573T probably damaging Het
Zc2hc1c C T 12: 85,289,821 S84F probably benign Het
Zfp143 A G 7: 110,091,784 D515G probably benign Het
Other mutations in Themis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Themis3 APN 17 66556097 missense probably benign 0.02
IGL01893:Themis3 APN 17 66559627 missense possibly damaging 0.52
IGL02065:Themis3 APN 17 66555905 missense probably benign 0.02
Nosedive UTSW 17 66559954 missense probably benign 0.18
Weightless UTSW 17 66555610 missense probably benign
R0345:Themis3 UTSW 17 66559545 critical splice donor site probably null
R0538:Themis3 UTSW 17 66593270 missense possibly damaging 0.95
R0583:Themis3 UTSW 17 66559753 missense probably benign 0.01
R1494:Themis3 UTSW 17 66559954 missense probably benign 0.18
R1713:Themis3 UTSW 17 66555853 missense probably benign 0.00
R2271:Themis3 UTSW 17 66555704 missense possibly damaging 0.57
R4214:Themis3 UTSW 17 66560017 missense probably benign 0.09
R5575:Themis3 UTSW 17 66555326 missense possibly damaging 0.85
R5815:Themis3 UTSW 17 66555704 missense possibly damaging 0.57
R6018:Themis3 UTSW 17 66593209 missense probably damaging 0.99
R7804:Themis3 UTSW 17 66555610 missense probably benign
R8241:Themis3 UTSW 17 66559967 missense probably benign 0.00
R8762:Themis3 UTSW 17 66559681 missense probably benign 0.00
Z1177:Themis3 UTSW 17 66555502 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- CATATAGAGGGTCTACAGTCATGG -3'
(R):5'- TATCAGGGCCTGGTGCTTAG -3'

Sequencing Primer
(F):5'- ATCTGGGCTGGTCACTCTGAC -3'
(R):5'- CCTGGTGCTTAGGAGAGGTC -3'
Posted On2020-07-28