Incidental Mutation 'R8054:Dnajc8'
ID643814
Institutional Source Beutler Lab
Gene Symbol Dnajc8
Ensembl Gene ENSMUSG00000054405
Gene NameDnaJ heat shock protein family (Hsp40) member C8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8054 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location132535550-132553742 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 132544757 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000067467] [ENSMUST00000094657] [ENSMUST00000105939] [ENSMUST00000105940] [ENSMUST00000138334] [ENSMUST00000139074] [ENSMUST00000144073]
Predicted Effect probably benign
Transcript: ENSMUST00000067467
SMART Domains Protein: ENSMUSP00000068069
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
SCOP:d1repc1 23 79 4e-5 SMART
Blast:DnaJ 56 79 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000094657
SMART Domains Protein: ENSMUSP00000092242
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 56 115 2.65e-18 SMART
low complexity region 135 146 N/A INTRINSIC
coiled coil region 164 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105939
SMART Domains Protein: ENSMUSP00000101559
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 22 81 2.09e-16 SMART
low complexity region 101 112 N/A INTRINSIC
coiled coil region 130 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105940
SMART Domains Protein: ENSMUSP00000101560
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 56 96 2.15e-1 SMART
low complexity region 116 127 N/A INTRINSIC
coiled coil region 145 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138334
SMART Domains Protein: ENSMUSP00000130135
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
DnaJ 38 84 4.42e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139074
Predicted Effect probably benign
Transcript: ENSMUST00000144073
SMART Domains Protein: ENSMUSP00000131575
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150207
SMART Domains Protein: ENSMUSP00000121009
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
DnaJ 32 91 2.65e-18 SMART
low complexity region 111 122 N/A INTRINSIC
low complexity region 178 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156385
SMART Domains Protein: ENSMUSP00000125885
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
coiled coil region 23 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b A G 5: 8,824,272 N399S probably benign Het
Akap9 T C 5: 4,038,707 probably null Het
Ankrd17 A G 5: 90,291,055 I483T probably benign Het
Arl13b T C 16: 62,806,597 D247G probably benign Het
Brca2 A G 5: 150,536,504 I415V probably benign Het
Brpf3 C A 17: 28,836,597 S1173R probably damaging Het
Ccar1 A G 10: 62,747,436 L966P unknown Het
Ccdc129 A T 6: 55,976,439 K913N probably damaging Het
Cfap61 A G 2: 145,973,518 N249S probably damaging Het
Clip4 T A 17: 71,834,273 Y541N possibly damaging Het
Csn2 C T 5: 87,698,027 probably null Het
Cyp2c23 T G 19: 44,007,116 E404A probably damaging Het
Cyp2e1 A G 7: 140,770,958 E281G possibly damaging Het
Cyp2r1 T A 7: 114,552,084 probably null Het
D430041D05Rik T A 2: 104,155,045 I1226F possibly damaging Het
Dbx1 A T 7: 49,632,750 W236R probably damaging Het
Dcp2 T G 18: 44,405,707 N251K probably benign Het
Disp1 A T 1: 183,088,248 Y869* probably null Het
Ehhadh A G 16: 21,773,493 probably null Het
Eml3 A T 19: 8,939,050 T670S possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbn1 A T 2: 125,346,018 D1530E possibly damaging Het
Gm11639 A G 11: 104,730,400 N822D probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hsd3b3 A T 3: 98,742,015 Y331N probably damaging Het
Ino80d T C 1: 63,058,678 R791G possibly damaging Het
Jade2 T C 11: 51,818,614 R523G probably benign Het
Kmt2d A T 15: 98,843,925 D4451E unknown Het
Lax1 T C 1: 133,683,607 T76A probably benign Het
Map4k1 A G 7: 28,989,756 probably benign Het
Mcu G A 10: 59,454,995 T121M probably damaging Het
Mepce T A 5: 137,784,742 K441* probably null Het
Mettl21e C A 1: 44,206,655 V144F probably damaging Het
Muc6 T A 7: 141,645,481 S1049C probably damaging Het
Myh14 C T 7: 44,625,127 V1246M probably damaging Het
Myo3a A T 2: 22,574,317 Q1128L probably benign Het
Nat8f2 T C 6: 85,867,772 S203G probably benign Het
Npas2 A G 1: 39,287,571 T46A possibly damaging Het
Nup133 T C 8: 123,949,217 probably benign Het
Olfr11 A T 13: 21,638,949 D191E probably benign Het
Olfr1375 T A 11: 51,048,263 I52N probably benign Het
Olfr213 A G 6: 116,540,999 H182R probably damaging Het
Olfr44 C A 9: 39,484,737 C172F probably damaging Het
Olfr998 A T 2: 85,590,840 Q100L probably damaging Het
Oplah C T 15: 76,306,257 R102H probably benign Het
Osgep C T 14: 50,924,671 probably benign Het
Pam A T 1: 97,840,389 D705E probably damaging Het
Papd5 T A 8: 88,247,558 I294N probably damaging Het
Pkd1l3 C G 8: 109,646,376 N1284K probably damaging Het
Plekhg2 A G 7: 28,365,316 F407S probably damaging Het
Pygl A G 12: 70,227,339 probably null Het
Rcc2 G A 4: 140,702,275 C40Y probably benign Het
Rhobtb1 A G 10: 69,248,890 N37S probably damaging Het
Sema6a T A 18: 47,291,905 D213V probably damaging Het
Skint11 A T 4: 114,244,609 Q273L possibly damaging Het
Skint7 A T 4: 111,982,229 H240L probably benign Het
Slc12a2 C T 18: 57,921,872 Q862* probably null Het
Smox A G 2: 131,522,180 S468G probably benign Het
Spc25 A G 2: 69,204,913 S50P probably damaging Het
Spert A G 14: 75,583,899 Y129H probably benign Het
Srrm1 A T 4: 135,325,015 S683T unknown Het
Syne1 T C 10: 5,270,970 E3103G probably benign Het
Tenm4 C A 7: 96,729,346 probably benign Het
Tmem123 T C 9: 7,791,063 S122P possibly damaging Het
Trav18 A T 14: 53,831,115 K4I probably benign Het
Triml1 T C 8: 43,130,383 S394G probably damaging Het
Ubr4 A T 4: 139,468,102 S1212C unknown Het
Usp34 G A 11: 23,361,295 R442Q Het
Usp43 G A 11: 67,891,458 P378L probably damaging Het
Vmn1r212 A G 13: 22,883,765 F133L probably benign Het
Vmn1r213 A G 13: 23,011,740 I164M possibly damaging Het
Vmn2r19 C T 6: 123,316,039 P347S probably damaging Het
Zfp106 A T 2: 120,524,519 V1280E possibly damaging Het
Zfp317 T C 9: 19,641,969 S13P probably benign Het
Zfp608 C A 18: 54,899,546 A441S probably benign Het
Zufsp T C 10: 33,940,252 D232G probably damaging Het
Other mutations in Dnajc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03211:Dnajc8 APN 4 132544737 missense possibly damaging 0.95
pith UTSW 4 132544720 missense probably damaging 0.98
R2130:Dnajc8 UTSW 4 132544059 missense possibly damaging 0.95
R3077:Dnajc8 UTSW 4 132544663 missense probably damaging 1.00
R5621:Dnajc8 UTSW 4 132553252 unclassified probably benign
R6921:Dnajc8 UTSW 4 132544720 missense probably damaging 0.98
R6925:Dnajc8 UTSW 4 132544113 missense probably damaging 0.99
R7255:Dnajc8 UTSW 4 132551573 missense probably benign 0.20
R8243:Dnajc8 UTSW 4 132551464 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTCCATTTACACTGCCTGAGC -3'
(R):5'- TGGGGACTAAAGGTGTCTATCAAC -3'

Sequencing Primer
(F):5'- AGTTGCTACTGGATCAGG -3'
(R):5'- AGTGGTAGTGTCCTAGCCACATC -3'
Posted On2020-08-26