Incidental Mutation 'R8333:Lrrc19'
ID644468
Institutional Source Beutler Lab
Gene Symbol Lrrc19
Ensembl Gene ENSMUSG00000049799
Gene Nameleucine rich repeat containing 19
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8333 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location94636653-94650144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94639350 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 208 (D208V)
Ref Sequence ENSEMBL: ENSMUSP00000056094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030311] [ENSMUST00000053419] [ENSMUST00000107101] [ENSMUST00000107104]
Predicted Effect probably benign
Transcript: ENSMUST00000030311
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053419
AA Change: D208V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000056094
Gene: ENSMUSG00000049799
AA Change: D208V

DomainStartEndE-ValueType
LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 250 364 8.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107101
AA Change: D208V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102718
Gene: ENSMUSG00000049799
AA Change: D208V

DomainStartEndE-ValueType
LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 245 364 9.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107104
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo2 T C 15: 97,245,285 T419A probably damaging Het
Baiap2l1 A C 5: 144,280,881 I298M possibly damaging Het
BC005624 G T 2: 30,973,736 A245D probably benign Het
Cdh23 T A 10: 60,314,611 I2527F probably damaging Het
Celsr1 T C 15: 86,031,414 H786R possibly damaging Het
Cerkl A G 2: 79,338,578 V427A possibly damaging Het
Cfap43 G T 19: 47,897,326 C283* probably null Het
Chfr G A 5: 110,154,937 A455T probably benign Het
Cldn13 T A 5: 134,914,996 I112F possibly damaging Het
Cyb5rl T A 4: 107,068,678 V19E probably benign Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dlgap2 T A 8: 14,778,295 C568S probably benign Het
Ecm2 T C 13: 49,518,383 L120P probably damaging Het
Gpr156 T C 16: 37,992,054 S251P probably damaging Het
Gpr182 T C 10: 127,749,921 N387S probably benign Het
Grid1 T C 14: 35,569,638 V834A possibly damaging Het
Igkv8-34 T C 6: 70,044,353 S42G probably benign Het
Kctd17 CAGCTGGAGGAGC CAGC 15: 78,436,913 probably benign Het
Lrrc9 C T 12: 72,481,543 T872I probably benign Het
Macf1 T C 4: 123,385,452 probably null Het
Mrpl13 A G 15: 55,557,283 M1T probably null Het
Ncapg C T 5: 45,674,463 T217I probably damaging Het
Nim1k G A 13: 119,712,486 P291S probably damaging Het
Olfr1077-ps1 A T 2: 86,526,071 Y35* probably null Het
Olfr251 G A 9: 38,378,616 G239D probably damaging Het
Padi6 T C 4: 140,737,376 M181V probably damaging Het
Pax7 T A 4: 139,830,203 I86F probably damaging Het
Pbk T A 14: 65,817,231 Y271N probably benign Het
Rabgap1 C T 2: 37,495,698 P492L probably benign Het
Rhno1 G T 6: 128,357,765 D198E probably damaging Het
Scn2a A C 2: 65,683,847 I292L probably benign Het
Slc40a1 T C 1: 45,911,279 S338G probably damaging Het
Slc45a3 A G 1: 131,978,190 Y317C probably damaging Het
Stard9 T A 2: 120,701,789 S2842R probably benign Het
Tle2 C T 10: 81,577,684 T119I probably damaging Het
Ttn C T 2: 76,723,594 V30922I possibly damaging Het
Usp33 C T 3: 152,374,660 P476L probably damaging Het
Wdr38 T C 2: 38,999,349 Y51H probably damaging Het
Other mutations in Lrrc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Lrrc19 APN 4 94638508 missense probably damaging 0.99
IGL02585:Lrrc19 APN 4 94643325 missense probably benign 0.00
R0087:Lrrc19 UTSW 4 94640772 missense probably damaging 1.00
R0629:Lrrc19 UTSW 4 94638252 missense probably damaging 1.00
R1172:Lrrc19 UTSW 4 94638389 nonsense probably null
R1572:Lrrc19 UTSW 4 94638429 missense probably damaging 1.00
R1576:Lrrc19 UTSW 4 94639353 missense probably damaging 1.00
R1589:Lrrc19 UTSW 4 94640950 missense probably benign 0.24
R2107:Lrrc19 UTSW 4 94639294 missense probably benign
R4734:Lrrc19 UTSW 4 94638349 missense probably benign 0.01
R4932:Lrrc19 UTSW 4 94640937 missense probably damaging 1.00
R6079:Lrrc19 UTSW 4 94643343 missense probably benign 0.17
R6969:Lrrc19 UTSW 4 94639373 missense probably benign 0.44
R7293:Lrrc19 UTSW 4 94638390 missense probably benign 0.07
R7596:Lrrc19 UTSW 4 94643355 missense probably benign
R7914:Lrrc19 UTSW 4 94638300 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCGTACCGATACCTTCAGCAATAG -3'
(R):5'- TGACATGCAAACTGAGTCACTATC -3'

Sequencing Primer
(F):5'- CCGATACCTTCAGCAATAGTAATATC -3'
(R):5'- GCACCATATGTATACCTGGTGACTG -3'
Posted On2020-09-02