Incidental Mutation 'R8335:Tacr2'
ID644584
Institutional Source Beutler Lab
Gene Symbol Tacr2
Ensembl Gene ENSMUSG00000020081
Gene Nametachykinin receptor 2
SynonymsTac2r
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8335 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location62252438-62265990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62265167 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 352 (H352L)
Ref Sequence ENSEMBL: ENSMUSP00000020278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020278] [ENSMUST00000072357] [ENSMUST00000099691] [ENSMUST00000116238] [ENSMUST00000130422]
Predicted Effect probably benign
Transcript: ENSMUST00000020278
AA Change: H352L

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020278
Gene: ENSMUSG00000020081
AA Change: H352L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 322 1.9e-11 PFAM
Pfam:7tm_1 50 307 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072357
SMART Domains Protein: ENSMUSP00000072195
Gene: ENSMUSG00000037012

DomainStartEndE-ValueType
Pfam:Hexokinase_1 25 224 1.2e-70 PFAM
Pfam:Hexokinase_2 229 486 8e-79 PFAM
Pfam:Hexokinase_1 496 695 7e-76 PFAM
Pfam:Hexokinase_2 700 934 4.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099691
SMART Domains Protein: ENSMUSP00000097282
Gene: ENSMUSG00000037012

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 221 1.9e-86 PFAM
Pfam:Hexokinase_2 223 462 1e-102 PFAM
Pfam:Hexokinase_1 464 669 1.1e-90 PFAM
Pfam:Hexokinase_2 671 910 2.2e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116238
SMART Domains Protein: ENSMUSP00000111946
Gene: ENSMUSG00000037012

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 225 1.3e-85 PFAM
Pfam:Hexokinase_2 227 357 3.6e-56 PFAM
Pfam:Hexokinase_2 362 489 9.3e-41 PFAM
Pfam:Hexokinase_1 491 696 2e-90 PFAM
Pfam:Hexokinase_2 698 937 3.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130422
SMART Domains Protein: ENSMUSP00000118601
Gene: ENSMUSG00000037012

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 220 1.4e-85 PFAM
Pfam:Hexokinase_2 222 461 1e-102 PFAM
Pfam:Hexokinase_1 463 668 1.1e-90 PFAM
Pfam:Hexokinase_2 670 909 2.2e-109 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a family of genes that function as receptors for tachykinins. Receptor affinities are specified by variations in the 5'-end of the sequence. The receptors belonging to this family are characterized by interactions with G proteins and 7 hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin neuropeptide substance K, also referred to as neurokinin A. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc47 C G 11: 106,208,258 E202D possibly damaging Het
Ccdc47 T C 11: 106,208,259 E202G probably damaging Het
Depdc1a C A 3: 159,523,222 P537Q probably damaging Het
Dync2h1 A T 9: 7,084,941 M2816K probably benign Het
Gatb T C 3: 85,574,321 probably null Het
Gm6356 A G 14: 6,971,838 M99T probably benign Het
Ighv1-67 A C 12: 115,604,124 V56G probably damaging Het
Il27ra A T 8: 84,039,501 L218Q probably damaging Het
Madd G A 2: 91,170,239 R494C probably damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mink1 C T 11: 70,609,575 R784W probably damaging Het
Mttp C T 3: 138,103,212 D697N possibly damaging Het
Mug2 A T 6: 122,040,584 M427L probably benign Het
Olfr1087 T A 2: 86,690,168 D269V probably benign Het
Olfr1122 A G 2: 87,387,860 I52V probably benign Het
Olfr1200 G T 2: 88,767,773 P181T probably damaging Het
Olfr1402 T C 3: 97,410,708 N158D probably benign Het
Paxip1 T C 5: 27,766,124 H409R unknown Het
Pkp3 T C 7: 141,087,756 I490T probably damaging Het
Plekhg4 G T 8: 105,376,216 V236L probably damaging Het
Pm20d2 T C 4: 33,189,245 S46G probably benign Het
Prss33 A G 17: 23,834,595 probably null Het
Ptpn3 A T 4: 57,235,286 L358I probably damaging Het
Pxdn A G 12: 30,002,097 T758A probably damaging Het
Sall3 G A 18: 80,969,586 R1212C probably benign Het
Sox6 G A 7: 115,701,714 L173F probably damaging Het
Spata20 T C 11: 94,482,543 K501E probably benign Het
Stat2 G A 10: 128,276,583 V31I possibly damaging Het
Synpo2 T A 3: 123,114,534 N378Y probably damaging Het
Tmem214 A G 5: 30,872,122 K230E possibly damaging Het
Tnfsf8 A G 4: 63,834,115 S238P probably damaging Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trhde A G 10: 114,486,704 probably null Het
Ttc6 A G 12: 57,660,291 I661M probably benign Het
Vmn1r209 T A 13: 22,805,807 M238L probably damaging Het
Vmn2r29 A G 7: 7,231,446 S814P probably damaging Het
Vsig10 T C 5: 117,348,370 L448P probably damaging Het
Zfp616 A T 11: 74,083,900 K423* probably null Het
Other mutations in Tacr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02756:Tacr2 APN 10 62261690 splice site probably benign
R1538:Tacr2 UTSW 10 62261327 critical splice donor site probably null
R3161:Tacr2 UTSW 10 62265245 missense probably benign 0.16
R3162:Tacr2 UTSW 10 62265245 missense probably benign 0.16
R3162:Tacr2 UTSW 10 62265245 missense probably benign 0.16
R3889:Tacr2 UTSW 10 62265086 missense probably damaging 1.00
R4193:Tacr2 UTSW 10 62253179 missense probably damaging 1.00
R4801:Tacr2 UTSW 10 62261548 missense probably damaging 1.00
R4802:Tacr2 UTSW 10 62261548 missense probably damaging 1.00
R5382:Tacr2 UTSW 10 62261497 missense probably damaging 1.00
R5751:Tacr2 UTSW 10 62252990 missense probably damaging 0.98
R7064:Tacr2 UTSW 10 62261497 missense probably damaging 1.00
R7412:Tacr2 UTSW 10 62261648 nonsense probably null
Z1177:Tacr2 UTSW 10 62258244 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCGAGGCTTCTTTGCAAGG -3'
(R):5'- ATGTAAGGGCTTTTCCATCAGC -3'

Sequencing Primer
(F):5'- TCTTTGCAAGGGAGCTAATCTC -3'
(R):5'- TCAGCCGATTCTCAAAGGG -3'
Posted On2020-09-02