Incidental Mutation 'R8335:Tnfsf8'
ID644573
Institutional Source Beutler Lab
Gene Symbol Tnfsf8
Ensembl Gene ENSMUSG00000028362
Gene Nametumor necrosis factor (ligand) superfamily, member 8
SynonymsCD153, CD30LG, Cd30L
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8335 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location63831308-63861347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63834115 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 238 (S238P)
Ref Sequence ENSEMBL: ENSMUSP00000030047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030047]
Predicted Effect probably damaging
Transcript: ENSMUST00000030047
AA Change: S238P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030047
Gene: ENSMUSG00000028362
AA Change: S238P

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 45 67 N/A INTRINSIC
TNF 103 235 2.64e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. This cytokine is a ligand for TNFRSF8/CD30, which is a cell surface antigen and a marker for Hodgkin lymphoma and related hematologic malignancies. The engagement of this cytokine expressed on B cell surface plays an inhibitory role in modulating Ig class switch. This cytokine was shown to enhance cell proliferation of some lymphoma cell lines, while to induce cell death and reduce cell proliferation of other lymphoma cell lines. The pleiotropic biologic activities of this cytokine on different CD30+ lymphoma cell lines may play a pathophysiologic role in Hodgkin's and some non-Hodgkin's lymphomas. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice diplay decreased susceptibility to graft versus host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc47 C G 11: 106,208,258 E202D possibly damaging Het
Ccdc47 T C 11: 106,208,259 E202G probably damaging Het
Depdc1a C A 3: 159,523,222 P537Q probably damaging Het
Dync2h1 A T 9: 7,084,941 M2816K probably benign Het
Gatb T C 3: 85,574,321 probably null Het
Gm6356 A G 14: 6,971,838 M99T probably benign Het
Ighv1-67 A C 12: 115,604,124 V56G probably damaging Het
Il27ra A T 8: 84,039,501 L218Q probably damaging Het
Madd G A 2: 91,170,239 R494C probably damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Mink1 C T 11: 70,609,575 R784W probably damaging Het
Mttp C T 3: 138,103,212 D697N possibly damaging Het
Mug2 A T 6: 122,040,584 M427L probably benign Het
Olfr1087 T A 2: 86,690,168 D269V probably benign Het
Olfr1122 A G 2: 87,387,860 I52V probably benign Het
Olfr1200 G T 2: 88,767,773 P181T probably damaging Het
Olfr1402 T C 3: 97,410,708 N158D probably benign Het
Paxip1 T C 5: 27,766,124 H409R unknown Het
Pkp3 T C 7: 141,087,756 I490T probably damaging Het
Plekhg4 G T 8: 105,376,216 V236L probably damaging Het
Pm20d2 T C 4: 33,189,245 S46G probably benign Het
Prss33 A G 17: 23,834,595 probably null Het
Ptpn3 A T 4: 57,235,286 L358I probably damaging Het
Pxdn A G 12: 30,002,097 T758A probably damaging Het
Sall3 G A 18: 80,969,586 R1212C probably benign Het
Sox6 G A 7: 115,701,714 L173F probably damaging Het
Spata20 T C 11: 94,482,543 K501E probably benign Het
Stat2 G A 10: 128,276,583 V31I possibly damaging Het
Synpo2 T A 3: 123,114,534 N378Y probably damaging Het
Tacr2 A T 10: 62,265,167 H352L probably benign Het
Tmem214 A G 5: 30,872,122 K230E possibly damaging Het
Tnn C T 1: 160,118,483 G922R probably damaging Het
Trhde A G 10: 114,486,704 probably null Het
Ttc6 A G 12: 57,660,291 I661M probably benign Het
Vmn1r209 T A 13: 22,805,807 M238L probably damaging Het
Vmn2r29 A G 7: 7,231,446 S814P probably damaging Het
Vsig10 T C 5: 117,348,370 L448P probably damaging Het
Zfp616 A T 11: 74,083,900 K423* probably null Het
Other mutations in Tnfsf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Tnfsf8 APN 4 63834510 splice site probably benign
P0045:Tnfsf8 UTSW 4 63851167 splice site probably benign
R0322:Tnfsf8 UTSW 4 63834166 missense probably damaging 0.96
R1167:Tnfsf8 UTSW 4 63837086 missense possibly damaging 0.55
R3821:Tnfsf8 UTSW 4 63860890 missense probably benign 0.17
R3893:Tnfsf8 UTSW 4 63860959 missense possibly damaging 0.86
R4154:Tnfsf8 UTSW 4 63834358 missense probably benign 0.00
R4380:Tnfsf8 UTSW 4 63861027 nonsense probably null
R4597:Tnfsf8 UTSW 4 63837100 missense probably damaging 1.00
R7502:Tnfsf8 UTSW 4 63851161 missense probably damaging 1.00
R7740:Tnfsf8 UTSW 4 63834446 missense possibly damaging 0.70
R8062:Tnfsf8 UTSW 4 63861195 start gained probably benign
R8126:Tnfsf8 UTSW 4 63834186 missense possibly damaging 0.94
R8301:Tnfsf8 UTSW 4 63860878 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- GAGACTCCACTTTCTAAATCCTGG -3'
(R):5'- ACCTGACATTGCAGCTCCTC -3'

Sequencing Primer
(F):5'- CCTGGGTTTGTATTTTTCCAAAGGAC -3'
(R):5'- TTCCAAGATCAAAAAGCAGACGTTG -3'
Posted On2020-09-02